Labshake search
Citations for Primerdesign :
1 - 6 of 6 citations for 6H BENZO CD PYREN 6 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... All reactions were carried out in triplicate using 18s and UBC (geNorm 6 gene kit, catalogue number ge-SY-6 from PrimerDesign UK) as housekeeping genes ...
-
bioRxiv - Microbiology 2019Quote: ... RNAemia levels were measured by a One-Step qRT-PCR detection kit (Oasig, Primerdesign Ltd., UK) and using DENV RT primer/probe Mix kit (Genesig ...
-
bioRxiv - Bioengineering 2019Quote: ... Gene expression was measured directly from 5 ng RNA using a one-step RT PCR kit with SYBR dye (PrimerDesign). qPCR was run on the BioRad CFX96 platform ...
-
bioRxiv - Bioengineering 2019Quote: ... Relative gene expression was measured from a total of 5 ng RNA using a one-step qPCR kit with SYBR dye (PrimerDesign) and normalized to GAPDH or 18S ribosomal RNA housekeeping gene ...
-
bioRxiv - Bioengineering 2020Quote: ... SPP1 and ALPL was determined using 5 ng of total RNA and a one-step SYBR-based quantitative polymerase chain reaction kit (PrimerDesign). Gene expression assays were run on a BioRad CFX96 platform ...
-
bioRxiv - Neuroscience 2023Quote: ... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...