Labshake search
Citations for Primerdesign :
1 - 5 of 5 citations for 6 Piperidino 1 purine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... All reactions were carried out in triplicate using 18s and UBC (geNorm 6 gene kit, catalogue number ge-SY-6 from PrimerDesign UK) as housekeeping genes ...
-
bioRxiv - Neuroscience 2023Quote: ... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
bioRxiv - Molecular Biology 2020Quote: ... qPCR reactions were performed in duplicate or triplicate in 10μl volumes using 2μl diluted cDNA (~8ng cDNA per well assuming 1:1 conversion) in a CFX384 lightcycler using PrecisionPLUS SYBR green qPCR mastermix (Primerdesign), with a melt curve included as standard (Supplementary Figure S1) ...
-
bioRxiv - Genetics 2019Quote: ... Primer sequences shown in appendix table 1 are copyrighted by PrimerDesign Ltd UK ...
-
bioRxiv - Bioengineering 2020Quote: ... RNA (1 µg) was transcribed using the Precision mqScript Reverse Transcription Kit (Primerdesign Ltd, UK) according to the manufacturer’s protocol and the cDNA was diluted 1:2 in molecular biology grade water (Sigma,UK) ...