Labshake search
Citations for Primerdesign :
1 - 7 of 7 citations for 6 Methoxypyridazine 3 Carboxylic Acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... All reactions were carried out in triplicate using 18s and UBC (geNorm 6 gene kit, catalogue number ge-SY-6 from PrimerDesign UK) as housekeeping genes ...
-
bioRxiv - Immunology 2021Quote: ... Primers (Supplementary Table 3) were purchased from Primerdesign Ltd (Primerdesign Ltd ...
-
bioRxiv - Microbiology 2020Quote: ... The extracted nucleic acids were tested using the commercial kit Path-ISKNV-EASY (Primerdesign, Southampton, UK) in the platform Genesig q16® (Primerdesign ...
-
bioRxiv - Immunology 2021Quote: ... glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and β-actin (ACTB) (Primerdesign Ltd), using the delta-CT or delta-delta Ct method[38].
-
bioRxiv - Microbiology 2020Quote: ... For this the homogenised tissues were subjected to total nucleic acids extraction (~20mg of each organ) using the Genesig Easy DNA/RNA Extraction Kit (Primerdesign) as described earlier ...
-
bioRxiv - Neuroscience 2023Quote: ... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
bioRxiv - Molecular Biology 2020Quote: ... Data were normalised to the geometric mean of the housekeeping genes (ubiquitin C and glyceraldehyde 3-phosphate dehydrogenase, probe-based duplex primer mix, PrimerDesign) and fold change in gene expression relative to controls was determined using the ΔΔCt method ...