Labshake search

1 - 5 of 5 citations for 6 Chloro 3 formylchromone since 2019

• An autocrine Vitamin D-driven Th1 shutdown program can be exploited for COVID-19

  Reuben McGregor, et al., bioRxiv - Immunology 2020

  Quote: ... All reactions were carried out in triplicate using 18s and UBC (geNorm 6 gene kit, catalogue number ge-SY-6 from PrimerDesign UK) as housekeeping genes ...
• Interleukin-17A causes osteoarthritis-like transcriptional changes in human osteoarthritis-derived chondrocytes and synovial fibroblasts in vitro

  Jolet Y. Mimpen, et al., bioRxiv - Immunology 2021

  Quote: ... Primers (Supplementary Table 3) were purchased from Primerdesign Ltd (Primerdesign Ltd ...
• Interleukin-17A causes osteoarthritis-like transcriptional changes in human osteoarthritis-derived chondrocytes and synovial fibroblasts in vitro

  Jolet Y. Mimpen, et al., bioRxiv - Immunology 2021

  Quote: ... glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and β-actin (ACTB) (Primerdesign Ltd), using the delta-CT or delta-delta Ct method[38].
• Endogenous epitope tagging of eEF1A2 in mice reveals early embryonic expression of eEF1A2 and subcellular compartmentalisation of neuronal eEF1A1 and eEF1A2

  Faith C.J. Davies, et al., bioRxiv - Neuroscience 2023

  Quote: ... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
• A novel isoform of ACE2 is expressed in human nasal and bronchial respiratory epithelia and is upregulated in response to RNA respiratory virus infection

  Cornelia Blume, et al., bioRxiv - Molecular Biology 2020

  Quote: ... Data were normalised to the geometric mean of the housekeeping genes (ubiquitin C and glyceraldehyde 3-phosphate dehydrogenase, probe-based duplex primer mix, PrimerDesign) and fold change in gene expression relative to controls was determined using the ΔΔCt method ...