Labshake search
Citations for Primerdesign :
1 - 10 of 10 citations for 5 NAPHTHALEN 1 YL 2H PYRAZOL 3 YLAMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Primers (Supplementary Table 3) were purchased from Primerdesign Ltd (Primerdesign Ltd ...
-
bioRxiv - Immunology 2021Quote: ... glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and β-actin (ACTB) (Primerdesign Ltd), using the delta-CT or delta-delta Ct method[38].
-
bioRxiv - Molecular Biology 2020Quote: ... Data were normalised to the geometric mean of the housekeeping genes (ubiquitin C and glyceraldehyde 3-phosphate dehydrogenase, probe-based duplex primer mix, PrimerDesign) and fold change in gene expression relative to controls was determined using the ΔΔCt method ...
-
bioRxiv - Bioengineering 2019Quote: ... Gene expression was measured directly from 5 ng RNA using a one-step RT PCR kit with SYBR dye (PrimerDesign). qPCR was run on the BioRad CFX96 platform ...
-
bioRxiv - Bioengineering 2019Quote: ... Relative gene expression was measured from a total of 5 ng RNA using a one-step qPCR kit with SYBR dye (PrimerDesign) and normalized to GAPDH or 18S ribosomal RNA housekeeping gene ...
-
bioRxiv - Bioengineering 2020Quote: ... SPP1 and ALPL was determined using 5 ng of total RNA and a one-step SYBR-based quantitative polymerase chain reaction kit (PrimerDesign). Gene expression assays were run on a BioRad CFX96 platform ...
-
bioRxiv - Neuroscience 2023Quote: ... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
bioRxiv - Molecular Biology 2020Quote: ... qPCR reactions were performed in duplicate or triplicate in 10μl volumes using 2μl diluted cDNA (~8ng cDNA per well assuming 1:1 conversion) in a CFX384 lightcycler using PrecisionPLUS SYBR green qPCR mastermix (Primerdesign), with a melt curve included as standard (Supplementary Figure S1) ...
-
bioRxiv - Genetics 2019Quote: ... Primer sequences shown in appendix table 1 are copyrighted by PrimerDesign Ltd UK ...
-
bioRxiv - Bioengineering 2020Quote: ... RNA (1 µg) was transcribed using the Precision mqScript Reverse Transcription Kit (Primerdesign Ltd, UK) according to the manufacturer’s protocol and the cDNA was diluted 1:2 in molecular biology grade water (Sigma,UK) ...