Labshake search
Citations for Applied Biological Materials :
1 - 25 of 25 citations for Zinc Finger With KRAB And SCAN Domains 5 ZKSCAN5 Antibody HRP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... Trans Genic Inc.) and HRP-conjugated goat anti-rabbit antibody (1:15 000 dilution, SH012; Applied Biological Materials). Chemiluminescence was detected using SuperSignal West Femto Max Sensitivity Substrate (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: Human ATG7 shRNA-GFP (5’-CAGTGGATCTAAATCTCAAACTGAT-3’) and scrambled control shRNA-GFP (5’-GGGTGAACTCACGTCAGAA −3’) lentiviral plasmids were purchased from Applied Biological Materials Inc ...
-
bioRxiv - Genetics 2020Quote: ... Reverse transcription was carried out using ‘5× All-in-one RT Mastermix’ (#g486; ABM), following the manufacturer instructions ...
-
bioRxiv - Immunology 2021Quote: ... anti-phospho-Rad52 antibody (Y408472, Applied Biological Materials Inc.) or anti-β-Actin mAb (2F1-1 ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by preparation of cDNA using 5× All-In- One RT MasterMix (Applied Biological Materials Inc.) as per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were stained with primary antibodies for 16 hours at 4 °C using the following antibodies: anti-GFP (Applied Biological Materials, G096, 1:1000), anti mCherry (novus biologicals ...
-
bioRxiv - Molecular Biology 2022Quote: ... an anti-His rabbit polyclonal antibody (ABM, Richland, BC, Canada) in combination with a polyclonal goat anti-rabbit HRP conjugated secondary antibody (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2022Quote: ... before reverse transcription to cDNA using a 5×All-In-One RT MasterMix (Applied Biological Materials Inc.). PhnsLTP1 ...
-
bioRxiv - Neuroscience 2023Quote: ... The cDNA was synthesized from total RNA by using 5×All-In-One RT MasterMix (ABM, China) following the standard protocols ...
-
bioRxiv - Cell Biology 2021Quote: ... chicken polyclonal antibodies to GFP (Applied Biological Materials G160, 1:1000); and human anti-ACA antibodies (Immunovision HCT-0100 ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-ß-actin mouse monoclonal antibody (Applied Biological Materials, Richmond, BC, Canada; #G043), anti-EEA1 mouse monoclonal antibody (BD Biosciences ...
-
bioRxiv - Microbiology 2020Quote: The recombinant adenovirus 5 expressing human ACE2 (Ad5-hACE2) and control adenovirus (Ad5-Ctrl) were purchased from ABM (Vancouver, Canada) or generated in the laboratory ...
-
bioRxiv - Cancer Biology 2022Quote: ... All cell lines were cultured in DMEM supplemented with 10% FBS and 100 units/mL penicillin/streptomycin under 5% CO2 at 37C and were routinely tested for mycoplasma contamination by ABM’s PCR Mycoplasma detection kit ...
-
bioRxiv - Cancer Biology 2024Quote: ... and were maintained in 100 units/mL penicillin/streptomycin under 5% CO2 at 37°C and routinely tested for mycoplasma contamination using the PCR Mycoplasma Detection Kit (ABM). Cells were cultured in the following media ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cDNA was synthesized from the isolated RNA by reverse transcription using RevertAid™ first strand cDNA synthesis kit (5× All-In-One RT MasterMix, ABM) according to the manufacturer’s instructions in a RNase-free environment ...
-
bioRxiv - Neuroscience 2021Quote: E15 DRG neurons in microfluidic devices were transduced on DIV1 with 5-10µl AAV9-axonal-GCaMP6s- P2A-mRuby3 (Broussard et al., 2018) (AAV9 was generated by Applied Biological Materials, Canada) alone or together with 25µl lentivirus expressing shRNA targeting tGFP ...
-
bioRxiv - Cancer Biology 2021Quote: ... The mRNA and miRNA reverse transcription were performed within a 5×All-In-One RT MasterMix kit (Applied Biological Materials, BC, Canada) and TaqMan microRNA Reverse Transcription Kit (Thermo Fisher ...
-
bioRxiv - Genomics 2021Quote: ... and PCR amplified using with a 5′-primer for mmu-miR-682 (CTGCAGTCACAGTGAAGTCTG) and the universal 3′ miRNA primer (Applied Biological Materials). Relative Ct values were calculated based on start-point samples and compared to the mid-(only for IL-KO ...
-
bioRxiv - Molecular Biology 2020Quote: cDNA synthesis was carried out with isolated total RNA using 5 X All-In-One RT MasterMix kit (Applied Biological Materials, G490) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: PAEC were transduced with adenoviral constructs encoding a constitutive active mutant of dual specificity mitogen-activated protein kinase 5 (caMEK5) (#000101A, Applied Biological Materials Inc); Flag-tagged KLF4 (#VH829440 ...
-
bioRxiv - Cell Biology 2019Quote: ... Membranes were stained with the following primary antibodies: rabbit anti-HA (1:4000; Applied Biological Materials, Richmond, Canada), mouse anti-GAPDH (1:1000 ...
-
bioRxiv - Biochemistry 2023Quote: The following primary antibodies were used for Western blotting: anti-His Tag (Applied Biological Materials, #G020; 1:4000), anti-HA Tag (Applied Biological Materials ...
-
bioRxiv - Neuroscience 2023Quote: ... The following primary antibodies (company, cat no.) were used in Western blot experiments: mouse anti-beta-actin (ABM, #G043), mouse anti-Flag (Sigma ...
-
bioRxiv - Microbiology 2020Quote: The mAb 3D11-expressing hybridoma cell line variable heavy and light chain antibody genes were sequenced (Applied Biological Materials Inc). mAb 3D11 VK and VH regions were cloned individually into custom pcDNA3.4 expression vectors immediately upstream of human Igκ and Igγ1-CH1 domains ...
-
bioRxiv - Molecular Biology 2021Quote: Variable light and heavy chains of mAb 2F2 and 2E10.E9 antibody genes were sequenced from the hybridomas (BEI Resources MRA-184 and MRA-185, respectively; Applied Biological Materials Inc). Sequenced regions were gene synthesized and cloned (GeneArt ...