Labshake search
Citations for Applied Biological Materials :
1 - 18 of 18 citations for Sumo2 3 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... human recombinant EGF (20 ng/mL; ABM), and human recombinant bFGF-2 (10ng/mL ...
-
bioRxiv - Molecular Biology 2020Quote: ... and dCas9 recombinant protein (Applied Biological Materials Inc.). After 10 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... and human recombinant bFGF-2 (10ng/mL; ABM). DMEM-F12 w/o L-Glutamine w/o Hepes w/o Glucose (Biowest ...
-
bioRxiv - Genetics 2020Quote: ... and human recombinant bFGF-2 (10ng/mL; ABM). Cells were monitored for mycoplasma contamination using MycoAlert (Lonza ...
-
bioRxiv - Genetics 2020Quote: ... human recombinant EGF (20 ng/mL; ABM, Richmond, BC, Canada) and human recombinant bFGF-2 (10ng/mL ...
-
bioRxiv - Microbiology 2023Quote: ... and co-transfected with recombinant saCas9 Nuclease NLS Protein (Applied Biological Materials Inc.), and a PCR-based puromycin resistance construct containing 5’- and 3’-UTRs of the targeted gene ...
-
bioRxiv - Microbiology 2020Quote: The mAb 3D11-expressing hybridoma cell line variable heavy and light chain antibody genes were sequenced (Applied Biological Materials Inc). mAb 3D11 VK and VH regions were cloned individually into custom pcDNA3.4 expression vectors immediately upstream of human Igκ and Igγ1-CH1 domains ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant adenovirus expressing human ACE2 (Ad5-hACE2) and control adenovirus (Ad5-Ctrl) were purchased from ABM (Vancouver, Canada).
-
bioRxiv - Physiology 2020Quote: ... and audible baseline monitor (model ABM-3, WPI) as previously described27 ...
-
bioRxiv - Cancer Biology 2020Quote: Human ATG7 shRNA-GFP (5’-CAGTGGATCTAAATCTCAAACTGAT-3’) and scrambled control shRNA-GFP (5’-GGGTGAACTCACGTCAGAA −3’) lentiviral plasmids were purchased from Applied Biological Materials Inc ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 µL Cas9 Reaction Buffer (Applied Biological Materials Inc.), 7.5 µL 300 nM CpG-targeting in vitro transcribed gRNA or non-CpG-targeting control gRNA ...
-
bioRxiv - Microbiology 2020Quote: The recombinant adenovirus 5 expressing human ACE2 (Ad5-hACE2) and control adenovirus (Ad5-Ctrl) were purchased from ABM (Vancouver, Canada) or generated in the laboratory ...
-
bioRxiv - Molecular Biology 2022Quote: ... an anti-His rabbit polyclonal antibody (ABM, Richland, BC, Canada) in combination with a polyclonal goat anti-rabbit HRP conjugated secondary antibody (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... The rabbit polyclonal to HA tag (Applied Biological Materials Cat# G166, RRID:AB_2813867). The Rabbit monoclonal to phospho-Smad 1/5 (Cell Signaling Technology Cat# 9516 ...
-
bioRxiv - Bioengineering 2021Quote: ... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
bioRxiv - Genomics 2021Quote: ... and PCR amplified using with a 5′-primer for mmu-miR-682 (CTGCAGTCACAGTGAAGTCTG) and the universal 3′ miRNA primer (Applied Biological Materials). Relative Ct values were calculated based on start-point samples and compared to the mid-(only for IL-KO ...
-
bioRxiv - Cell Biology 2019Quote: ... Membranes were stained with the following primary antibodies: rabbit anti-HA (1:4000; Applied Biological Materials, Richmond, Canada), mouse anti-GAPDH (1:1000 ...
-
bioRxiv - Neuroscience 2020Quote: ... Trans Genic Inc.) and HRP-conjugated goat anti-rabbit antibody (1:15 000 dilution, SH012; Applied Biological Materials). Chemiluminescence was detected using SuperSignal West Femto Max Sensitivity Substrate (Thermo Fisher Scientific ...