Labshake search
Citations for Applied Biological Materials :
1 - 47 of 47 citations for Mouse IgG2b Isotype Control Antibody A 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: Adeno-associated virus serotype 8 expressing mouse Aig1 and AAV8-GFP control were purchased from Applied Biological Materials (Canada). AAV injection was carried out as previously described57 ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GAPDH (1:1000; Applied Biological Materials), mouse anti-GFP (1:1000 ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GFP (1:1000, Applied Biological Materials) and with rabbit or mouse-peroxidase secondary antibodies (1:10,000 ...
-
bioRxiv - Cell Biology 2023Quote: ... miRNA Mimic Negative Control (ABM-MCH00000, abm), and Anti-miR™ miRNA Inhibitor (AM17000 ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-ß-actin mouse monoclonal antibody (Applied Biological Materials, Richmond, BC, Canada; #G043), anti-EEA1 mouse monoclonal antibody (BD Biosciences ...
-
bioRxiv - Cancer Biology 2021Quote: Real-time PCR was performed for miR-21-5p in A2780R cells infected with lentivirus from Zip control (pLenti-III-miR-GFP control vector from Applied Biological Materials #m001) or Zip-21 (LentimiRa-GFP-has-miR-21-5p vector ...
-
bioRxiv - Cancer Biology 2023Quote: ... Scrambled sgRNA vector was used as negative control (ABM Inc., K010)
-
bioRxiv - Cell Biology 2020Quote: ... and pLenti-III-miR-GFP Control Vector (Cat: M001, Applied Biological Materials) were purified using the EndoFree Plasmid Maxi Prep Kit (Cat ...
-
bioRxiv - Neuroscience 2023Quote: ... The following primary antibodies (company, cat no.) were used in Western blot experiments: mouse anti-beta-actin (ABM, #G043), mouse anti-Flag (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... chicken polyclonal antibodies to GFP (Applied Biological Materials G160, 1:1000); and human anti-ACA antibodies (Immunovision HCT-0100 ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were stained with primary antibodies for 16 hours at 4 °C using the following antibodies: anti-GFP (Applied Biological Materials, G096, 1:1000), anti mCherry (novus biologicals ...
-
bioRxiv - Microbiology 2021Quote: ... As negative control we used a scrambled sgRNA sequence: GCACTCACATCGCTACATCA (Applied Biological Materials, Richmond, BC, Canada). MIF-ko-5:CACCGAGCTCGGAGAGGAACCCGTC and MIF-ko-3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and control vehicle plasmid (pLenti-CMV-RFP-2A-Puro-Blank Vector, Applied Biological Materials Inc. Cat# LV591) to generate 3T3-L1 cell lines that do (3T3-POSTN ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant adenovirus expressing human ACE2 (Ad5-hACE2) and control adenovirus (Ad5-Ctrl) were purchased from ABM (Vancouver, Canada).
-
bioRxiv - Cell Biology 2019Quote: ... Membranes were stained with the following primary antibodies: rabbit anti-HA (1:4000; Applied Biological Materials, Richmond, Canada), mouse anti-GAPDH (1:1000 ...
-
bioRxiv - Neuroscience 2020Quote: ... Trans Genic Inc.) and HRP-conjugated goat anti-rabbit antibody (1:15 000 dilution, SH012; Applied Biological Materials). Chemiluminescence was detected using SuperSignal West Femto Max Sensitivity Substrate (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: The following primary antibodies were used for Western blotting: anti-His Tag (Applied Biological Materials, #G020; 1:4000), anti-HA Tag (Applied Biological Materials ...
-
bioRxiv - Cell Biology 2021Quote: ... Stocks of Lenti-Control and Lenti-NICD3 were titrated by qPCR (catalog number LV900, ABM® good, Richmond, BC, Canada) and their infectivity confirmed by flow cytometry via quantification of GFP+ cells ...
-
bioRxiv - Microbiology 2020Quote: The recombinant adenovirus 5 expressing human ACE2 (Ad5-hACE2) and control adenovirus (Ad5-Ctrl) were purchased from ABM (Vancouver, Canada) or generated in the laboratory ...
-
bioRxiv - Biochemistry 2024Quote: ... or mouse anti-α-tubulin (ABM # G094) at 1:8000 for a loading control ...
-
bioRxiv - Microbiology 2022Quote: ... 2μl of pre-amplified cDNA or NRT control reaction was used as template for multiplexed real-time PCR reactions using TaqProbe 5x qPCR MasterMix-Multiplex (ABM MasterMix-5PM), 5% DMSO ...
-
bioRxiv - Cancer Biology 2020Quote: Human ATG7 shRNA-GFP (5’-CAGTGGATCTAAATCTCAAACTGAT-3’) and scrambled control shRNA-GFP (5’-GGGTGAACTCACGTCAGAA −3’) lentiviral plasmids were purchased from Applied Biological Materials Inc ...
-
bioRxiv - Immunology 2021Quote: ... Immortalized mouse dendritic cells (MutuDC1940, Applied Biological Materials Inc. #T0528) were cultured in Iscove’s DMEM medium supplemented with 10% fetal calf serum ...
-
bioRxiv - Immunology 2021Quote: ... anti-phospho-Rad52 antibody (Y408472, Applied Biological Materials Inc.) or anti-β-Actin mAb (2F1-1 ...
-
bioRxiv - Physiology 2023Quote: Human VSMCs and mouse VSMCs were purchased from Applied Biological Materials (T0515, Richmond, Canada) and American Type Culture Collection (ATCC) ...
-
bioRxiv - Cancer Biology 2023Quote: ... the mouse Ehd1 lentiviral vector (pLenti-GIII-CMV-RFP-2A-Puro) (#190510640495; Applied Biological Materials) was stably transduced into TC71-EHD1-KO ...
-
bioRxiv - Molecular Biology 2022Quote: ... an anti-His rabbit polyclonal antibody (ABM, Richland, BC, Canada) in combination with a polyclonal goat anti-rabbit HRP conjugated secondary antibody (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were incubated with 1μg/mL of mouse anti-Flag (Applied Biological Materials Inc., Richmond, BC, Canada), 0.25 μg/mL of rabbit anti-SARS-CoV-2-Nsp1 (Genetex ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Lentiviruses were produced from sets of four mouse piLenti-siRNA-GFP lentiviral vectors (Applied Biological Materials, Inc. Richmond, BC, Canada) targeting Pelp1 (cat no ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse St8sia1 sgRNA CRISPR/Cas9 All-in-One Lentivector (pLenti-U6-sgRNA-SFFV-Cas9-2A-Puro; #456551140595, Applied Biological Materials) with three target sequences Target 1-17 ...
-
bioRxiv - Systems Biology 2022Quote: ... and 1% penicillin/streptomycin (ABM) and grown in a 5% CO2 humidified atmosphere at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... was from Addgene (#27704). Lentiviral Mouse EHD2 vector (pLenti-GIII-CMV-GFP-2A-puro, cat. # 190520640395) was from Applied Biological Materials (Richmond, BC, Canada). Luciferase/tdTomatao reporter was engineered using the MuLE system kit from Addgene (Cat ...
-
bioRxiv - Bioengineering 2021Quote: ... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
bioRxiv - Bioengineering 2023Quote: ... with 1% antibiotic-antimycotic solution (ABM, Thermo Fischer) on gelatin-coated (2% ...
-
bioRxiv - Microbiology 2020Quote: The mAb 3D11-expressing hybridoma cell line variable heavy and light chain antibody genes were sequenced (Applied Biological Materials Inc). mAb 3D11 VK and VH regions were cloned individually into custom pcDNA3.4 expression vectors immediately upstream of human Igκ and Igγ1-CH1 domains ...
-
bioRxiv - Cell Biology 2023Quote: ... and 1% (v/v) antibiotic/antimycotic solution (ABM; Gibco).
-
bioRxiv - Biochemistry 2023Quote: ... anti-HA Tag (Applied Biological Materials, #G166; 1:1000), anti-G6PD (Abcam ...
-
bioRxiv - Molecular Biology 2021Quote: Variable light and heavy chains of mAb 2F2 and 2E10.E9 antibody genes were sequenced from the hybridomas (BEI Resources MRA-184 and MRA-185, respectively; Applied Biological Materials Inc). Sequenced regions were gene synthesized and cloned (GeneArt ...
-
bioRxiv - Immunology 2023Quote: ... BlasTaq™ 2X qPCR MasterMix (ref. G892-1, Applied Biological Materials, Vancouver, Canada) and specific primers were used to assess gene transcripts expression for following targets ...
-
bioRxiv - Cell Biology 2022Quote: Total cell lysates (RPE1, MC3T3) were isolated using RIPA buffer supplemented with 1:100 protease (Applied Biological Materials, G135). Mouse tissue disruption and homogenization was performed in RIPA buffer supplemented with 1:100 protease using Tissue Lyser LT (Qiagen) ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was synthesized from 1 μg RNA by using the OneScript® Plus cDNA Synthesis Kit (Applied Biological Materials Inc.). Gene-specific primers pairs (Table S1 ...
-
bioRxiv - Cell Biology 2020Quote: Resist-coated silicon wafers were patterned with circles (Diameter: 1 µm; Center-to-center spacing: 2 µm) using 220 nm deep UV lithography (ABM, USA). Then ...
-
bioRxiv - Cancer Biology 2022Quote: ... with an additional modification of a deletion of 1 adenosine in the 10-A polynucleotide sequence in exon 10 (codons 771-774) of the ATR cDNA sequence (Applied Biological Materials).
-
bioRxiv - Cell Biology 2023Quote: ... Mycoplasma negativity of the original cell lines (hTERT RPE-1 and 293T) grown in antibiotics-free media were confirmed by a PCR based test (G238, Applied Biological Materials).
-
bioRxiv - Cell Biology 2023Quote: ... Mycoplasma negativity of the original cell lines (hTERT RPE-1 and 293T) grown in antibiotics-free media were confirmed by a PCR based test (G238, Applied Biological Materials).
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... The cell suspension was then diluted in StemFlex with ROCK inhibitor to a concentration of 1e6 cell/mL and mixed with 50uL aliquots of both tetO-ALN-PuroR and pUBIQ-rtTA viruses tittered at an estimated 1 × 107 IU/mL using a qPCR Lentivirus Titration Kit (Applied Biological Materials, #LV900). hiPSCs were plated on Matrigel-coated plates and incubated at 37°C with virus overnight ...
-
bioRxiv - Bioengineering 2024Quote: ... Subsequently these layers were patterned into 1 cm x 10 or 20 µm strips via photolithography (ABM-USA, INC., Jan Jose, CA, USA) and a wet chemical etching of titanium and copper with copper etchant (Millipore Sigma ...