Labshake search
Citations for Applied Biological Materials :
1 - 40 of 40 citations for Mouse Anti Dengue Virus NS1 Serotype 3 Antibody CC6 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: Adeno-associated virus serotype 8 expressing mouse Aig1 and AAV8-GFP control were purchased from Applied Biological Materials (Canada). AAV injection was carried out as previously described57 ...
-
bioRxiv - Physiology 2023Quote: ... was subcloned and packaged in an AAV serotype retrograde (Applied Biological Materials, Inc.) ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-ß-actin mouse monoclonal antibody (Applied Biological Materials, Richmond, BC, Canada; #G043), anti-EEA1 mouse monoclonal antibody (BD Biosciences ...
-
bioRxiv - Neuroscience 2023Quote: ... The following primary antibodies (company, cat no.) were used in Western blot experiments: mouse anti-beta-actin (ABM, #G043), mouse anti-Flag (Sigma ...
-
bioRxiv - Biochemistry 2024Quote: ... or mouse anti-α-tubulin (ABM # G094) at 1:8000 for a loading control ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GAPDH (1:1000; Applied Biological Materials), mouse anti-GFP (1:1000 ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GFP (1:1000, Applied Biological Materials) and with rabbit or mouse-peroxidase secondary antibodies (1:10,000 ...
-
bioRxiv - Immunology 2021Quote: PAOC cells were immortalized with Lenti-hTERT virus (ABM; cat# G200) following manufacturer’s instructions and clonal sorting/expansion ...
-
bioRxiv - Neuroscience 2022Quote: ... Adeno-associated virus (AAV) was purchased from Applied Biological Materials (abm). AAV-mir-GFP-Blank Control Virus (Serotype 8 ...
-
bioRxiv - Immunology 2021Quote: ... anti-phospho-Rad52 antibody (Y408472, Applied Biological Materials Inc.) or anti-β-Actin mAb (2F1-1 ...
-
bioRxiv - Neuroscience 2022Quote: ... The titer was determined using the qPCR Adeno-Associated Virus Titration kit (Applied Biological Materials) and the purity was verified by SDS-PAGE and total protein staining using instant blue reagent (Expedeon) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The virus titer was determined using a qPCR Lentivirus Titration Kit (#LV900, Applied Biological Materials). For lentiviral transduction ...
-
bioRxiv - Immunology 2023Quote: ... The titer was determined using the qPCR Adeno-Associated Virus Titration kit (Applied Biological Materials) and the purity was verified by SDS–PAGE and total protein staining using InstantBlue reagent (Expedeon).
-
bioRxiv - Molecular Biology 2022Quote: ... an anti-His rabbit polyclonal antibody (ABM, Richland, BC, Canada) in combination with a polyclonal goat anti-rabbit HRP conjugated secondary antibody (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: The titer of the virus preparations was determined by using the qPCR lentivirus titration kit (Applied Biological Materials, USA) as per the manufacturer-recommended protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... Virus titre was quantified using the qPCR Lentivirus Titration Kit according to manufacturer’s directions (Applied Biological Materials, British Columbia, Canada).
-
bioRxiv - Microbiology 2022Quote: ... Membranes were incubated with 1μg/mL of mouse anti-Flag (Applied Biological Materials Inc., Richmond, BC, Canada), 0.25 μg/mL of rabbit anti-SARS-CoV-2-Nsp1 (Genetex ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were stained with primary antibodies for 16 hours at 4 °C using the following antibodies: anti-GFP (Applied Biological Materials, G096, 1:1000), anti mCherry (novus biologicals ...
-
bioRxiv - Physiology 2020Quote: ... and audible baseline monitor (model ABM-3, WPI) as previously described27 ...
-
bioRxiv - Cell Biology 2019Quote: ... Membranes were stained with the following primary antibodies: rabbit anti-HA (1:4000; Applied Biological Materials, Richmond, Canada), mouse anti-GAPDH (1:1000 ...
-
bioRxiv - Neuroscience 2020Quote: ... Trans Genic Inc.) and HRP-conjugated goat anti-rabbit antibody (1:15 000 dilution, SH012; Applied Biological Materials). Chemiluminescence was detected using SuperSignal West Femto Max Sensitivity Substrate (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: The following primary antibodies were used for Western blotting: anti-His Tag (Applied Biological Materials, #G020; 1:4000), anti-HA Tag (Applied Biological Materials ...
-
bioRxiv - Cancer Biology 2020Quote: Human ATG7 shRNA-GFP (5’-CAGTGGATCTAAATCTCAAACTGAT-3’) and scrambled control shRNA-GFP (5’-GGGTGAACTCACGTCAGAA −3’) lentiviral plasmids were purchased from Applied Biological Materials Inc ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 µL Cas9 Reaction Buffer (Applied Biological Materials Inc.), 7.5 µL 300 nM CpG-targeting in vitro transcribed gRNA or non-CpG-targeting control gRNA ...
-
bioRxiv - Immunology 2021Quote: ... Immortalized mouse dendritic cells (MutuDC1940, Applied Biological Materials Inc. #T0528) were cultured in Iscove’s DMEM medium supplemented with 10% fetal calf serum ...
-
bioRxiv - Bioengineering 2021Quote: ... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
bioRxiv - Physiology 2023Quote: Human VSMCs and mouse VSMCs were purchased from Applied Biological Materials (T0515, Richmond, Canada) and American Type Culture Collection (ATCC) ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-V5 Tag (ABM G189), anti-Vinculin (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... the mouse Ehd1 lentiviral vector (pLenti-GIII-CMV-RFP-2A-Puro) (#190510640495; Applied Biological Materials) was stably transduced into TC71-EHD1-KO ...
-
bioRxiv - Bioengineering 2020Quote: ... and anti-beta-actin (G043, ABM) were used for detecting endogenous TAGLN2 proteins ...
-
bioRxiv - Cell Biology 2021Quote: ... chicken polyclonal antibodies to GFP (Applied Biological Materials G160, 1:1000); and human anti-ACA antibodies (Immunovision HCT-0100 ...
-
bioRxiv - Genomics 2021Quote: ... and PCR amplified using with a 5′-primer for mmu-miR-682 (CTGCAGTCACAGTGAAGTCTG) and the universal 3′ miRNA primer (Applied Biological Materials). Relative Ct values were calculated based on start-point samples and compared to the mid-(only for IL-KO ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-HA (Applied Biological Materials, G166,1:4000), anti-VPS4 (Sigma-Aldrich ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Lentiviruses were produced from sets of four mouse piLenti-siRNA-GFP lentiviral vectors (Applied Biological Materials, Inc. Richmond, BC, Canada) targeting Pelp1 (cat no ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse St8sia1 sgRNA CRISPR/Cas9 All-in-One Lentivector (pLenti-U6-sgRNA-SFFV-Cas9-2A-Puro; #456551140595, Applied Biological Materials) with three target sequences Target 1-17 ...
-
bioRxiv - Biochemistry 2023Quote: ... anti-HA Tag (Applied Biological Materials, #G166; 1:1000), anti-G6PD (Abcam ...
-
bioRxiv - Cancer Biology 2022Quote: ... was from Addgene (#27704). Lentiviral Mouse EHD2 vector (pLenti-GIII-CMV-GFP-2A-puro, cat. # 190520640395) was from Applied Biological Materials (Richmond, BC, Canada). Luciferase/tdTomatao reporter was engineered using the MuLE system kit from Addgene (Cat ...
-
bioRxiv - Biochemistry 2021Quote: ... probed with anti-His (Applied Biological Materials Inc, Richmond, Canada) and Streptavidin-HRP (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: The mAb 3D11-expressing hybridoma cell line variable heavy and light chain antibody genes were sequenced (Applied Biological Materials Inc). mAb 3D11 VK and VH regions were cloned individually into custom pcDNA3.4 expression vectors immediately upstream of human Igκ and Igγ1-CH1 domains ...
-
bioRxiv - Molecular Biology 2021Quote: Variable light and heavy chains of mAb 2F2 and 2E10.E9 antibody genes were sequenced from the hybridomas (BEI Resources MRA-184 and MRA-185, respectively; Applied Biological Materials Inc). Sequenced regions were gene synthesized and cloned (GeneArt ...