Labshake search
Citations for Applied Biological Materials :
1 - 23 of 23 citations for Leucine Rich Repeats And Immunoglobulin Like Domains Protein 3 LRIG3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Verification of cell lines was performed by Short Tandem Repeat (STR) DNA profiling (Applied Biological Materials Inc, Canada).
-
bioRxiv - Developmental Biology 2021Quote: ... directly upstream of 24 MS2 repeats and a yellow reporter gene by Applied Biological Materials (Richmond, BC, Canada). We defined kni_-5 as chr3L:20699503-20700905(–) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The cell line identities were confirmed by genotyping using short tandem repeat fingerprinting and were tested negative for mycoplasma with Mycoplasma PCR Detection Kit (ABM).
-
bioRxiv - Physiology 2020Quote: ... and audible baseline monitor (model ABM-3, WPI) as previously described27 ...
-
bioRxiv - Cancer Biology 2020Quote: Human ATG7 shRNA-GFP (5’-CAGTGGATCTAAATCTCAAACTGAT-3’) and scrambled control shRNA-GFP (5’-GGGTGAACTCACGTCAGAA −3’) lentiviral plasmids were purchased from Applied Biological Materials Inc ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 µL Cas9 Reaction Buffer (Applied Biological Materials Inc.), 7.5 µL 300 nM CpG-targeting in vitro transcribed gRNA or non-CpG-targeting control gRNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... and dCas9 recombinant protein (Applied Biological Materials Inc.). After 10 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... and co-transfected with recombinant saCas9 Nuclease NLS Protein (Applied Biological Materials Inc.), and a PCR-based puromycin resistance construct containing 5’- and 3’-UTRs of the targeted gene ...
-
bioRxiv - Bioengineering 2021Quote: ... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... anti-phospho-Rad52 antibody (Y408472, Applied Biological Materials Inc.) or anti-β-Actin mAb (2F1-1 ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were stained with primary antibodies for 16 hours at 4 °C using the following antibodies: anti-GFP (Applied Biological Materials, G096, 1:1000), anti mCherry (novus biologicals ...
-
bioRxiv - Molecular Biology 2022Quote: ... an anti-His rabbit polyclonal antibody (ABM, Richland, BC, Canada) in combination with a polyclonal goat anti-rabbit HRP conjugated secondary antibody (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... chicken polyclonal antibodies to GFP (Applied Biological Materials G160, 1:1000); and human anti-ACA antibodies (Immunovision HCT-0100 ...
-
bioRxiv - Genomics 2021Quote: ... and PCR amplified using with a 5′-primer for mmu-miR-682 (CTGCAGTCACAGTGAAGTCTG) and the universal 3′ miRNA primer (Applied Biological Materials). Relative Ct values were calculated based on start-point samples and compared to the mid-(only for IL-KO ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-ß-actin mouse monoclonal antibody (Applied Biological Materials, Richmond, BC, Canada; #G043), anti-EEA1 mouse monoclonal antibody (BD Biosciences ...
-
bioRxiv - Cancer Biology 2023Quote: All-in-one lentiviral vectors encoding both the RNA guide (gRNA) and the Cas9 protein for AR gene deletion were obtained from Applied Biological Materials Inc ...
-
bioRxiv - Molecular Biology 2020Quote: PAEC were transduced with adenoviral constructs encoding a constitutive active mutant of dual specificity mitogen-activated protein kinase 5 (caMEK5) (#000101A, Applied Biological Materials Inc); Flag-tagged KLF4 (#VH829440 ...
-
bioRxiv - Cell Biology 2019Quote: ... Membranes were stained with the following primary antibodies: rabbit anti-HA (1:4000; Applied Biological Materials, Richmond, Canada), mouse anti-GAPDH (1:1000 ...
-
bioRxiv - Neuroscience 2020Quote: ... Trans Genic Inc.) and HRP-conjugated goat anti-rabbit antibody (1:15 000 dilution, SH012; Applied Biological Materials). Chemiluminescence was detected using SuperSignal West Femto Max Sensitivity Substrate (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: The following primary antibodies were used for Western blotting: anti-His Tag (Applied Biological Materials, #G020; 1:4000), anti-HA Tag (Applied Biological Materials ...
-
bioRxiv - Neuroscience 2023Quote: ... The following primary antibodies (company, cat no.) were used in Western blot experiments: mouse anti-beta-actin (ABM, #G043), mouse anti-Flag (Sigma ...
-
bioRxiv - Microbiology 2020Quote: The mAb 3D11-expressing hybridoma cell line variable heavy and light chain antibody genes were sequenced (Applied Biological Materials Inc). mAb 3D11 VK and VH regions were cloned individually into custom pcDNA3.4 expression vectors immediately upstream of human Igκ and Igγ1-CH1 domains ...
-
bioRxiv - Molecular Biology 2021Quote: Variable light and heavy chains of mAb 2F2 and 2E10.E9 antibody genes were sequenced from the hybridomas (BEI Resources MRA-184 and MRA-185, respectively; Applied Biological Materials Inc). Sequenced regions were gene synthesized and cloned (GeneArt ...