Labshake search
Citations for Applied Biological Materials :
1 - 45 of 45 citations for LAG 3 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: HEK293 Expressing Rpn11-HTBH (Applied Biological Materials, T6007)
-
bioRxiv - Biochemistry 2021Quote: HEK293 Expressing Rpn11-HTBH (Applied Biological Materials, T6007)
-
bioRxiv - Biochemistry 2021Quote: ... probed with anti-His (Applied Biological Materials Inc, Richmond, Canada) and Streptavidin-HRP (ThermoFisher Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: ... an anti-His rabbit polyclonal antibody (ABM, Richland, BC, Canada) in combination with a polyclonal goat anti-rabbit HRP conjugated secondary antibody (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: The following primary antibodies were used for Western blotting: anti-His Tag (Applied Biological Materials, #G020; 1:4000), anti-HA Tag (Applied Biological Materials ...
-
bioRxiv - Cancer Biology 2022Quote: ... human recombinant EGF (20 ng/mL; ABM), and human recombinant bFGF-2 (10ng/mL ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human HC cells immortalized by human telomerase reverse transcriptase (hTERT) expression were purchased from Applied Biological Materials (cat. no. T0570). The cell lines used were not further authenticated ...
-
bioRxiv - Cancer Biology 2022Quote: ... and human recombinant bFGF-2 (10ng/mL; ABM). DMEM-F12 w/o L-Glutamine w/o Hepes w/o Glucose (Biowest ...
-
bioRxiv - Genetics 2020Quote: ... and human recombinant bFGF-2 (10ng/mL; ABM). Cells were monitored for mycoplasma contamination using MycoAlert (Lonza ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human colonic cells (hCC; T0570, Applied biological materials, Inc.) were cultured in DMEM supplemented with 10% FBS in 5% CO2/air humidified atmosphere at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... and human endometrial stromal cells (hESCs; T0533 ABM, Canada) were utilized in this study ...
-
bioRxiv - Physiology 2020Quote: ... and audible baseline monitor (model ABM-3, WPI) as previously described27 ...
-
bioRxiv - Bioengineering 2020Quote: ... Human SV40-immortalized microglia are purchased from Applied Biological Materials, Inc and cultured in Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
bioRxiv - Genetics 2020Quote: ... human recombinant EGF (20 ng/mL; ABM, Richmond, BC, Canada) and human recombinant bFGF-2 (10ng/mL ...
-
bioRxiv - Cancer Biology 2021Quote: ... COL-hTERT (Immortalized Human Colon Cells) were purchased from ABM. TM31 were obtained from RIKEN BioResource Research Center ...
-
bioRxiv - Neuroscience 2023Quote: ... Human KCNJ3-HA plasmid was purchased from Applied Biological Materials (Richmond ...
-
bioRxiv - Cancer Biology 2020Quote: Human ATG7 shRNA-GFP (5’-CAGTGGATCTAAATCTCAAACTGAT-3’) and scrambled control shRNA-GFP (5’-GGGTGAACTCACGTCAGAA −3’) lentiviral plasmids were purchased from Applied Biological Materials Inc ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 µL Cas9 Reaction Buffer (Applied Biological Materials Inc.), 7.5 µL 300 nM CpG-targeting in vitro transcribed gRNA or non-CpG-targeting control gRNA ...
-
bioRxiv - Cell Biology 2021Quote: T0034 immortalized human skeletal muscle cell line was purchased from ABM. Cell were maintained in Prigrow III medium (ABM) ...
-
bioRxiv - Immunology 2022Quote: ... and immortalized human cardiac fibroblasts (iHCF, Applied Biological Materials Inc., T0446) were grown in FibroGRO LS medium (Millipore ...
-
bioRxiv - Cell Biology 2023Quote: The immortalized (SV40) human microglial cell line was acquired from ABM. Human microglial cells were cultured in cell culture flasks coated with 50 μg/ml rat tail collagen I (Gibco ...
-
bioRxiv - Neuroscience 2022Quote: Human immortalized microglial cell line SV-40 (T0251, Applied Biological Materials Inc.) originates from the Tardieu lab(30 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The human microglia (hMG) cell line was purchased from Applied Biological Materials (ABM). Mouse glioblastoma cell GL261 was generously provided by Dr ...
-
bioRxiv - Immunology 2024Quote: Immortalized human fetal astrocytes-SV40 (IMhu-A) (Applied Biological Materials, Cat. No. T0280) cells were grown in Roswell Park Memorial Institute (RPMI)-HEPES medium (Sigma-Aldrich ...
-
bioRxiv - Physiology 2023Quote: Human VSMCs and mouse VSMCs were purchased from Applied Biological Materials (T0515, Richmond, Canada) and American Type Culture Collection (ATCC) ...
-
bioRxiv - Genomics 2024Quote: ... SV40-immortalized human microglia cells (Cat.No: T0251, Applied Biological Materials Inc, Richmond, QC, Canada), was cultured in Prigrow III medium with 10% (vol/vol ...
-
bioRxiv - Cancer Biology 2021Quote: HKDC1 sgRNA CRISPR All-in-One Lentivirus (Human) (Cat No. 234181110603) was purchased from ABM and HepG2 cells (70% confluent ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentivirus particles expressing human α-syn under cytomegalovirus (CMV) promoter (Applied Biological Materials, Inc, Canada) was used to re-express α-syn in SK-MEL-28 KO cells as described previously30 ...
-
bioRxiv - Immunology 2024Quote: ... The immortalized human microglia-SV40 (IMhu-M) cell line (Applied Biological Materials, Cat. No. T0251), HEK293(T ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentivirus particles expressing human α-syn under cytomegalovirus (CMV) promoter (Applied Biological Materials, Inc, Canada) was used to re-express α-syn in SK-MEL-28 SNCA-KO cells as described previously27
-
bioRxiv - Biochemistry 2024Quote: ... and human CDC14A siRNA and scrambled siRNA (i504211) were from Applied Biological Materials (Richmond, BC, Canada). FAK-14 inhibitor was from Tocris Bioscience (Bristol ...
-
bioRxiv - Cell Biology 2024Quote: ... The CRISPR/Cas9 system specifically targeting human ATG7 (K0142505) was purchased from Applied Biological Materials (ABM) Inc ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant adenovirus expressing human ACE2 (Ad5-hACE2) and control adenovirus (Ad5-Ctrl) were purchased from ABM (Vancouver, Canada).
-
bioRxiv - Cell Biology 2020Quote: ... lentiviral sgRNA targeting human LDLR (Cat# 264181110204) and non-viral plasmids containing sgRNA targeting individual candidate genes were purchased from ABM Goods ...
-
bioRxiv - Microbiology 2020Quote: The recombinant adenovirus 5 expressing human ACE2 (Ad5-hACE2) and control adenovirus (Ad5-Ctrl) were purchased from ABM (Vancouver, Canada) or generated in the laboratory ...
-
bioRxiv - Genetics 2022Quote: The SMN1 AAV Vector (Human; hSyn; Luc) (#444551011210) containing the functional, synthetic SMN1 gene (GenBank accession code, NM_000344) was obtained from Applied Biological Materials Inc ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: For all experiments human embryonic kidney (HEK) 293SL cells84 were used and regularly tested for mycoplasma contamination (PCR Mycoplasma Detection kit, ABM, Canada). HEK293SL cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) ...
-
bioRxiv - Bioengineering 2021Quote: ... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... ready-to-use lentivirus particles containing three unique sgRNA targeting human Itch or viruses containing scrambled sgRNA were purchased from Applied Biological Materials Inc ...
-
bioRxiv - Developmental Biology 2022Quote: The use of human embryos donated for this project was allowed by the Agence de la Biomédecine (ABM, approval number RE 17- 011R) in compliance with the International Society for Stem Cell Research guidelines32 ...
-
bioRxiv - Cell Biology 2020Quote: Stably Cas9-expressing HepG2 cells were transduced at a multiplicity of infection (MOI) of 1.5 with lentivirus containing a sgRNA targeting human LDLR (ABM Goods, Inc. Canada, Cat# 264181110204) and a neomycin selection marker ...
-
bioRxiv - Bioengineering 2022Quote: ... Adventitia-derived pericytes were isolated from non-aneurysmal human aortic specimens and immortalized to improve culture longevity using a lentiviral vector system to deliver HPV-E6/E7 (ABM, Richmond, British Columbia, Canada) using previously described methods.22,23
-
bioRxiv - Genomics 2021Quote: ... and PCR amplified using with a 5′-primer for mmu-miR-682 (CTGCAGTCACAGTGAAGTCTG) and the universal 3′ miRNA primer (Applied Biological Materials). Relative Ct values were calculated based on start-point samples and compared to the mid-(only for IL-KO ...
-
bioRxiv - Cancer Biology 2023Quote: 3T3-L1 cells were stably transfected with a human POSTN lentiviral vector (pLenti-GIII-CMV-RFP-2A-Puro-POSTN, Applied Biological Materials Inc. Cat# LV268492) and control vehicle plasmid (pLenti-CMV-RFP-2A-Puro-Blank Vector ...
-
bioRxiv - Cancer Biology 2023Quote: ... in a pLenti-Puro vector (pLenti-All-in-one-U6-sgRNA human Zeb1 (target1) or scramble -SFFV-Cas9 nuclease-2A-Puro) (Applied Biological Materials Inc., Richmond, Canada). The sequences of the sgRNA targeting ZEB1 are the following ...