Labshake search
Citations for Applied Biological Materials :
1 - 27 of 27 citations for Integrin alpha 5 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: The recombinant adenovirus 5 expressing human ACE2 (Ad5-hACE2) and control adenovirus (Ad5-Ctrl) were purchased from ABM (Vancouver, Canada) or generated in the laboratory ...
-
bioRxiv - Neuroscience 2023Quote: alpha-synuclein-HA-tag adenovirus were obtained from Applied Biological Materials Inc ...
-
bioRxiv - Cancer Biology 2022Quote: ... human recombinant EGF (20 ng/mL; ABM), and human recombinant bFGF-2 (10ng/mL ...
-
bioRxiv - Molecular Biology 2020Quote: ... and dCas9 recombinant protein (Applied Biological Materials Inc.). After 10 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... and human recombinant bFGF-2 (10ng/mL; ABM). DMEM-F12 w/o L-Glutamine w/o Hepes w/o Glucose (Biowest ...
-
bioRxiv - Genetics 2020Quote: ... and human recombinant bFGF-2 (10ng/mL; ABM). Cells were monitored for mycoplasma contamination using MycoAlert (Lonza ...
-
bioRxiv - Genetics 2020Quote: ... human recombinant EGF (20 ng/mL; ABM, Richmond, BC, Canada) and human recombinant bFGF-2 (10ng/mL ...
-
bioRxiv - Microbiology 2023Quote: ... and co-transfected with recombinant saCas9 Nuclease NLS Protein (Applied Biological Materials Inc.), and a PCR-based puromycin resistance construct containing 5’- and 3’-UTRs of the targeted gene ...
-
bioRxiv - Microbiology 2020Quote: The mAb 3D11-expressing hybridoma cell line variable heavy and light chain antibody genes were sequenced (Applied Biological Materials Inc). mAb 3D11 VK and VH regions were cloned individually into custom pcDNA3.4 expression vectors immediately upstream of human Igκ and Igγ1-CH1 domains ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant adenovirus expressing human ACE2 (Ad5-hACE2) and control adenovirus (Ad5-Ctrl) were purchased from ABM (Vancouver, Canada).
-
bioRxiv - Cancer Biology 2020Quote: Human ATG7 shRNA-GFP (5’-CAGTGGATCTAAATCTCAAACTGAT-3’) and scrambled control shRNA-GFP (5’-GGGTGAACTCACGTCAGAA −3’) lentiviral plasmids were purchased from Applied Biological Materials Inc ...
-
bioRxiv - Molecular Biology 2022Quote: ... an anti-His rabbit polyclonal antibody (ABM, Richland, BC, Canada) in combination with a polyclonal goat anti-rabbit HRP conjugated secondary antibody (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... The rabbit polyclonal to HA tag (Applied Biological Materials Cat# G166, RRID:AB_2813867). The Rabbit monoclonal to phospho-Smad 1/5 (Cell Signaling Technology Cat# 9516 ...
-
bioRxiv - Genetics 2020Quote: ... Reverse transcription was carried out using ‘5× All-in-one RT Mastermix’ (#g486; ABM), following the manufacturer instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by preparation of cDNA using 5× All-In- One RT MasterMix (Applied Biological Materials Inc.) as per the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... before reverse transcription to cDNA using a 5×All-In-One RT MasterMix (Applied Biological Materials Inc.). PhnsLTP1 ...
-
bioRxiv - Neuroscience 2023Quote: ... The cDNA was synthesized from total RNA by using 5×All-In-One RT MasterMix (ABM, China) following the standard protocols ...
-
bioRxiv - Cell Biology 2019Quote: ... Membranes were stained with the following primary antibodies: rabbit anti-HA (1:4000; Applied Biological Materials, Richmond, Canada), mouse anti-GAPDH (1:1000 ...
-
bioRxiv - Neuroscience 2020Quote: ... Trans Genic Inc.) and HRP-conjugated goat anti-rabbit antibody (1:15 000 dilution, SH012; Applied Biological Materials). Chemiluminescence was detected using SuperSignal West Femto Max Sensitivity Substrate (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... All cell lines were cultured in DMEM supplemented with 10% FBS and 100 units/mL penicillin/streptomycin under 5% CO2 at 37C and were routinely tested for mycoplasma contamination by ABM’s PCR Mycoplasma detection kit ...
-
bioRxiv - Cancer Biology 2024Quote: ... and were maintained in 100 units/mL penicillin/streptomycin under 5% CO2 at 37°C and routinely tested for mycoplasma contamination using the PCR Mycoplasma Detection Kit (ABM). Cells were cultured in the following media ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cDNA was synthesized from the isolated RNA by reverse transcription using RevertAid™ first strand cDNA synthesis kit (5× All-In-One RT MasterMix, ABM) according to the manufacturer’s instructions in a RNase-free environment ...
-
bioRxiv - Neuroscience 2021Quote: E15 DRG neurons in microfluidic devices were transduced on DIV1 with 5-10µl AAV9-axonal-GCaMP6s- P2A-mRuby3 (Broussard et al., 2018) (AAV9 was generated by Applied Biological Materials, Canada) alone or together with 25µl lentivirus expressing shRNA targeting tGFP ...
-
bioRxiv - Cancer Biology 2021Quote: ... The mRNA and miRNA reverse transcription were performed within a 5×All-In-One RT MasterMix kit (Applied Biological Materials, BC, Canada) and TaqMan microRNA Reverse Transcription Kit (Thermo Fisher ...
-
bioRxiv - Genomics 2021Quote: ... and PCR amplified using with a 5′-primer for mmu-miR-682 (CTGCAGTCACAGTGAAGTCTG) and the universal 3′ miRNA primer (Applied Biological Materials). Relative Ct values were calculated based on start-point samples and compared to the mid-(only for IL-KO ...
-
bioRxiv - Molecular Biology 2020Quote: cDNA synthesis was carried out with isolated total RNA using 5 X All-In-One RT MasterMix kit (Applied Biological Materials, G490) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: PAEC were transduced with adenoviral constructs encoding a constitutive active mutant of dual specificity mitogen-activated protein kinase 5 (caMEK5) (#000101A, Applied Biological Materials Inc); Flag-tagged KLF4 (#VH829440 ...