Labshake search
Citations for Applied Biological Materials :
1 - 36 of 36 citations for Fipronil 3 Cyano Pyrazole 3 4 5 13C4 99%; 3 Cyano 5 15N2 98% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: Human ATG7 shRNA-GFP (5’-CAGTGGATCTAAATCTCAAACTGAT-3’) and scrambled control shRNA-GFP (5’-GGGTGAACTCACGTCAGAA −3’) lentiviral plasmids were purchased from Applied Biological Materials Inc ...
-
bioRxiv - Genomics 2021Quote: ... and PCR amplified using with a 5′-primer for mmu-miR-682 (CTGCAGTCACAGTGAAGTCTG) and the universal 3′ miRNA primer (Applied Biological Materials). Relative Ct values were calculated based on start-point samples and compared to the mid-(only for IL-KO ...
-
bioRxiv - Physiology 2020Quote: ... and audible baseline monitor (model ABM-3, WPI) as previously described27 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 µL Cas9 Reaction Buffer (Applied Biological Materials Inc.), 7.5 µL 300 nM CpG-targeting in vitro transcribed gRNA or non-CpG-targeting control gRNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... All cell lines were cultured in DMEM supplemented with 10% FBS and 100 units/mL penicillin/streptomycin under 5% CO2 at 37C and were routinely tested for mycoplasma contamination by ABM’s PCR Mycoplasma detection kit ...
-
bioRxiv - Bioengineering 2021Quote: ... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
bioRxiv - Genetics 2020Quote: ... Reverse transcription was carried out using ‘5× All-in-one RT Mastermix’ (#g486; ABM), following the manufacturer instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by preparation of cDNA using 5× All-In- One RT MasterMix (Applied Biological Materials Inc.) as per the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... before reverse transcription to cDNA using a 5×All-In-One RT MasterMix (Applied Biological Materials Inc.). PhnsLTP1 ...
-
bioRxiv - Neuroscience 2023Quote: ... The cDNA was synthesized from total RNA by using 5×All-In-One RT MasterMix (ABM, China) following the standard protocols ...
-
bioRxiv - Microbiology 2020Quote: The recombinant adenovirus 5 expressing human ACE2 (Ad5-hACE2) and control adenovirus (Ad5-Ctrl) were purchased from ABM (Vancouver, Canada) or generated in the laboratory ...
-
bioRxiv - Cancer Biology 2024Quote: ... and were maintained in 100 units/mL penicillin/streptomycin under 5% CO2 at 37°C and routinely tested for mycoplasma contamination using the PCR Mycoplasma Detection Kit (ABM). Cells were cultured in the following media ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cDNA was synthesized from the isolated RNA by reverse transcription using RevertAid™ first strand cDNA synthesis kit (5× All-In-One RT MasterMix, ABM) according to the manufacturer’s instructions in a RNase-free environment ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 2 ug of RNA was treated with an AccuRT Genomic DNA Removal Kit (Applied Biological Materials, Richmond, BC, Canada) prior to cDNA synthesis using the 5X All-In-One Master mix (Applied Biological Materials) ...
-
bioRxiv - Neuroscience 2021Quote: E15 DRG neurons in microfluidic devices were transduced on DIV1 with 5-10µl AAV9-axonal-GCaMP6s- P2A-mRuby3 (Broussard et al., 2018) (AAV9 was generated by Applied Biological Materials, Canada) alone or together with 25µl lentivirus expressing shRNA targeting tGFP ...
-
bioRxiv - Cancer Biology 2021Quote: ... The mRNA and miRNA reverse transcription were performed within a 5×All-In-One RT MasterMix kit (Applied Biological Materials, BC, Canada) and TaqMan microRNA Reverse Transcription Kit (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2020Quote: cDNA synthesis was carried out with isolated total RNA using 5 X All-In-One RT MasterMix kit (Applied Biological Materials, G490) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: PAEC were transduced with adenoviral constructs encoding a constitutive active mutant of dual specificity mitogen-activated protein kinase 5 (caMEK5) (#000101A, Applied Biological Materials Inc); Flag-tagged KLF4 (#VH829440 ...
-
bioRxiv - Neuroscience 2021Quote: ... up to a maximum of 4 runs (64 blocks - 32 ABM, 32 WM). The two distinct block types (ABM and WM ...
-
bioRxiv - Systems Biology 2021Quote: ... This process (20 sets of initial guesses × 10 ABM runs × 100 generations) was repeated 30 times ...
-
bioRxiv - Cancer Biology 2022Quote: ... human recombinant EGF (20 ng/mL; ABM), and human recombinant bFGF-2 (10ng/mL ...
-
bioRxiv - Cancer Biology 2022Quote: ... and human recombinant bFGF-2 (10ng/mL; ABM). DMEM-F12 w/o L-Glutamine w/o Hepes w/o Glucose (Biowest ...
-
bioRxiv - Genetics 2020Quote: ... and human recombinant bFGF-2 (10ng/mL; ABM). Cells were monitored for mycoplasma contamination using MycoAlert (Lonza ...
-
bioRxiv - Genetics 2020Quote: ... human recombinant EGF (20 ng/mL; ABM, Richmond, BC, Canada) and human recombinant bFGF-2 (10ng/mL ...
-
bioRxiv - Microbiology 2022Quote: ... syringae Lz4W was routinely grown at 22°C or 4°C (for optimum and low temperatures respectively) in Antarctic bacterial medium (ABM) composed of 5 g/l peptone and 2.0 g/l yeast extract ...
-
bioRxiv - Cell Biology 2022Quote: Total cell lysates (RPE1, MC3T3) were isolated using RIPA buffer supplemented with 1:100 protease (Applied Biological Materials, G135). Mouse tissue disruption and homogenization was performed in RIPA buffer supplemented with 1:100 protease using Tissue Lyser LT (Qiagen) ...
-
bioRxiv - Bioengineering 2024Quote: ... woodii was cultivated in 12 ml of acetobacterium medium (DSMZ 135, referred as ABM) which was prepared according to DSMZ’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... The cDNA was prepared from 100-200 ng of total RNA using 5xAll-In-One RT Master mix (Applied Biological Materials Inc). Real-time PCR was performed using Fast SYBR Green Master Mix ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were stained with primary antibodies for 16 hours at 4 °C using the following antibodies: anti-GFP (Applied Biological Materials, G096, 1:1000), anti mCherry (novus biologicals ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were incubated with 1μg/mL of mouse anti-Flag (Applied Biological Materials Inc., Richmond, BC, Canada), 0.25 μg/mL of rabbit anti-SARS-CoV-2-Nsp1 (Genetex ...
-
bioRxiv - Physiology 2021Quote: ... cells were infected using Lenti-SV40 (ts58 temperature sensitive mutant, 106 IU/mL, LV629, Applied Biological Materials) Lentivirus to achieve temperature sensitive immortalization ...
-
bioRxiv - Cancer Biology 2022Quote: ... The lentivirus titer determined using the qPCR lentivirus titer kit was ~108 IU/mL (Applied Biological Materials).
-
bioRxiv - Immunology 2023Quote: ... The lentivirus titer determined using the qPCR lentivirus titer kit was >109 IU/mL (Applied Biological Materials).
-
bioRxiv - Neuroscience 2020Quote: High titers (>1012 gc/mL) of AAV1 viral particles containing Tet1 isoform TALE constructs were packaged by Applied Biological Materials (ABM). For primary hippocampal neuron experiments in 12 or 24 well plates ...
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... The cell suspension was then diluted in StemFlex with ROCK inhibitor to a concentration of 1e6 cell/mL and mixed with 50uL aliquots of both tetO-ALN-PuroR and pUBIQ-rtTA viruses tittered at an estimated 1 × 107 IU/mL using a qPCR Lentivirus Titration Kit (Applied Biological Materials, #LV900). hiPSCs were plated on Matrigel-coated plates and incubated at 37°C with virus overnight ...
-
bioRxiv - Neuroscience 2021Quote: ... The production of lentiviral particles up to 109 IU/ml was purified by Ultra-Pure Lentivirus purification kits (Applied Biological Materials Inc. Vancouver). AAV preparation ...