Labshake search
Citations for Applied Biological Materials :
1 - 30 of 30 citations for Adenovirus Type 5 Particles Wild type since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: The recombinant adenovirus 5 expressing human ACE2 (Ad5-hACE2) and control adenovirus (Ad5-Ctrl) were purchased from ABM (Vancouver, Canada) or generated in the laboratory ...
-
bioRxiv - Neuroscience 2021Quote: ... The two distinct block types (ABM and WM) were predicted to activate the DMN and CEN respectively ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant adenovirus expressing human ACE2 (Ad5-hACE2) and control adenovirus (Ad5-Ctrl) were purchased from ABM (Vancouver, Canada).
-
bioRxiv - Physiology 2022Quote: ... primary adipocytes were transduced with adenoviral constructs (Cre-GFP Adenovirus, #000023A; GFP Adenovirus, #000541A, both from Applied Biological Materials).
-
bioRxiv - Neuroscience 2023Quote: alpha-synuclein-HA-tag adenovirus were obtained from Applied Biological Materials Inc ...
-
bioRxiv - Neuroscience 2023Quote: ... Neurons were then treated for 48h with α-syn-HA adenovirus (Applied Biological Materials) at concentration of 2 x 105 IFU/PFU (infectious unit)/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... Viral particles were tittered via qPCR (ABM qPCR Lentivirus Titration Kit) before storage at −80°C.
-
bioRxiv - Genetics 2022Quote: ... Lentiviral shRNA particles were titered using the qPCR Lentiviral Titration Kit (ABM). shRNA particles were transduced into 12Z cells at a 100-fold multiplicity of infection ...
-
bioRxiv - Cancer Biology 2020Quote: 1205Lu cells were transfected with FADS2 targeting shRNA lentiviral particles (Applied Biological Materials, shFADS2 #1 ...
-
bioRxiv - Cell Biology 2022Quote: ... lentiviral particles were titrated using the qPCR lentivirus titration kit (Applied Biological Materials Inc.) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentivirus particles expressing human α-syn under cytomegalovirus (CMV) promoter (Applied Biological Materials, Inc, Canada) was used to re-express α-syn in SK-MEL-28 KO cells as described previously30 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentivirus particles expressing human α-syn under cytomegalovirus (CMV) promoter (Applied Biological Materials, Inc, Canada) was used to re-express α-syn in SK-MEL-28 SNCA-KO cells as described previously27
-
bioRxiv - Cell Biology 2023Quote: ... HaCaT cells were transfected with pLenti-EF1a-Cas9-Puro lentiviral particles (Applied Biological Materials, Richmond, Canada) and selected with 1 µg/mL puromycin (Thermo Fischer Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Concentrations of viral particles were verified via qPCR using a lentiviral titration kit from Applied Biological Materials on QuantStudio 3 from Thermo Fisher.
-
bioRxiv - Neuroscience 2020Quote: High titers (>1012 gc/mL) of AAV1 viral particles containing Tet1 isoform TALE constructs were packaged by Applied Biological Materials (ABM). For primary hippocampal neuron experiments in 12 or 24 well plates ...
-
bioRxiv - Immunology 2023Quote: ... ready-to-use lentivirus particles containing three unique sgRNA targeting human Itch or viruses containing scrambled sgRNA were purchased from Applied Biological Materials Inc ...
-
bioRxiv - Neuroscience 2021Quote: ... The production of lentiviral particles up to 109 IU/ml was purified by Ultra-Pure Lentivirus purification kits (Applied Biological Materials Inc. Vancouver). AAV preparation ...
-
bioRxiv - Cancer Biology 2020Quote: Human ATG7 shRNA-GFP (5’-CAGTGGATCTAAATCTCAAACTGAT-3’) and scrambled control shRNA-GFP (5’-GGGTGAACTCACGTCAGAA −3’) lentiviral plasmids were purchased from Applied Biological Materials Inc ...
-
bioRxiv - Genetics 2020Quote: ... Reverse transcription was carried out using ‘5× All-in-one RT Mastermix’ (#g486; ABM), following the manufacturer instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by preparation of cDNA using 5× All-In- One RT MasterMix (Applied Biological Materials Inc.) as per the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... before reverse transcription to cDNA using a 5×All-In-One RT MasterMix (Applied Biological Materials Inc.). PhnsLTP1 ...
-
bioRxiv - Neuroscience 2023Quote: ... The cDNA was synthesized from total RNA by using 5×All-In-One RT MasterMix (ABM, China) following the standard protocols ...
-
bioRxiv - Cancer Biology 2022Quote: ... All cell lines were cultured in DMEM supplemented with 10% FBS and 100 units/mL penicillin/streptomycin under 5% CO2 at 37C and were routinely tested for mycoplasma contamination by ABM’s PCR Mycoplasma detection kit ...
-
bioRxiv - Cancer Biology 2024Quote: ... and were maintained in 100 units/mL penicillin/streptomycin under 5% CO2 at 37°C and routinely tested for mycoplasma contamination using the PCR Mycoplasma Detection Kit (ABM). Cells were cultured in the following media ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cDNA was synthesized from the isolated RNA by reverse transcription using RevertAid™ first strand cDNA synthesis kit (5× All-In-One RT MasterMix, ABM) according to the manufacturer’s instructions in a RNase-free environment ...
-
bioRxiv - Neuroscience 2021Quote: E15 DRG neurons in microfluidic devices were transduced on DIV1 with 5-10µl AAV9-axonal-GCaMP6s- P2A-mRuby3 (Broussard et al., 2018) (AAV9 was generated by Applied Biological Materials, Canada) alone or together with 25µl lentivirus expressing shRNA targeting tGFP ...
-
bioRxiv - Cancer Biology 2021Quote: ... The mRNA and miRNA reverse transcription were performed within a 5×All-In-One RT MasterMix kit (Applied Biological Materials, BC, Canada) and TaqMan microRNA Reverse Transcription Kit (Thermo Fisher ...
-
bioRxiv - Genomics 2021Quote: ... and PCR amplified using with a 5′-primer for mmu-miR-682 (CTGCAGTCACAGTGAAGTCTG) and the universal 3′ miRNA primer (Applied Biological Materials). Relative Ct values were calculated based on start-point samples and compared to the mid-(only for IL-KO ...
-
bioRxiv - Molecular Biology 2020Quote: cDNA synthesis was carried out with isolated total RNA using 5 X All-In-One RT MasterMix kit (Applied Biological Materials, G490) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: PAEC were transduced with adenoviral constructs encoding a constitutive active mutant of dual specificity mitogen-activated protein kinase 5 (caMEK5) (#000101A, Applied Biological Materials Inc); Flag-tagged KLF4 (#VH829440 ...