Labshake search
Citations for Applied Biological Materials :
1 - 11 of 11 citations for 8 9 Didehydro 3'N demethyl 9 deoxo 4'' 6 12 trideoxy 6 9 epoxy 3'N ethylerythromycin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Paleontology 2023Quote: The sample comprises Iron Age 2 Abel Beth Maacah (ABM, N=74); Iron Age 2 Tel Dor (Dor ...
-
bioRxiv - Physiology 2020Quote: ... and audible baseline monitor (model ABM-3, WPI) as previously described27 ...
-
bioRxiv - Cancer Biology 2020Quote: Human ATG7 shRNA-GFP (5’-CAGTGGATCTAAATCTCAAACTGAT-3’) and scrambled control shRNA-GFP (5’-GGGTGAACTCACGTCAGAA −3’) lentiviral plasmids were purchased from Applied Biological Materials Inc ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 µL Cas9 Reaction Buffer (Applied Biological Materials Inc.), 7.5 µL 300 nM CpG-targeting in vitro transcribed gRNA or non-CpG-targeting control gRNA ...
-
bioRxiv - Bioengineering 2021Quote: ... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
bioRxiv - Genomics 2021Quote: ... and PCR amplified using with a 5′-primer for mmu-miR-682 (CTGCAGTCACAGTGAAGTCTG) and the universal 3′ miRNA primer (Applied Biological Materials). Relative Ct values were calculated based on start-point samples and compared to the mid-(only for IL-KO ...
-
bioRxiv - Bioengineering 2024Quote: ... woodii was cultivated in 12 ml of acetobacterium medium (DSMZ 135, referred as ABM) which was prepared according to DSMZ’s instructions ...
-
bioRxiv - Physiology 2023Quote: Adeno-associated virus serotype 8 expressing mouse Aig1 and AAV8-GFP control were purchased from Applied Biological Materials (Canada). AAV injection was carried out as previously described57 ...
-
bioRxiv - Neuroscience 2021Quote: ... up to a maximum of 4 runs (64 blocks - 32 ABM, 32 WM). The two distinct block types (ABM and WM ...
-
bioRxiv - Microbiology 2022Quote: ... syringae Lz4W was routinely grown at 22°C or 4°C (for optimum and low temperatures respectively) in Antarctic bacterial medium (ABM) composed of 5 g/l peptone and 2.0 g/l yeast extract ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were stained with primary antibodies for 16 hours at 4 °C using the following antibodies: anti-GFP (Applied Biological Materials, G096, 1:1000), anti mCherry (novus biologicals ...