Labshake search
Citations for Applied Biological Materials :
1 - 45 of 45 citations for 7α 12α Dihydroxycholest 4 en 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ZNF692 sgRNA CRISPR/Cas9 All-in-One Lentivector or Scrambled sgRNA CRISPR/Cas9 All-in-One Lentivector (Applied Biological Materials) was transfected together with lentiviral packaging plasmids pSPAX2 and pMD2g to HEK293FT cells ...
-
bioRxiv - Immunology 2023Quote: ... or ABM All-in-one RT kit (ABM) was used to synthesize cDNA according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Reverse transcription was performed to generate cDNA using 5X All-In-One RT MasterMix (with AccuRT Ge5X All-In-One RT MasterMix and AccuRT Genomic DNA Removal Kit) (Applied Biological Materials) for RT–qPCR ...
-
bioRxiv - Physiology 2023Quote: ... RNA samples underwent reverse transcription (All-in-one RT Master Mix – ABM). qPCR was performed with BrightGreen Express reagent (ABM ...
-
bioRxiv - Microbiology 2019Quote: ... Total cDNA was synthesized using the All-In-One RT Master Mix (ABM). For RT-qPCR ...
-
bioRxiv - Genomics 2021Quote: miRNA All-In-One cDNA Synthesis Kit (Applied Biological Materials, Richmond, BC, Canada) was used to convert RNA to generate ...
-
bioRxiv - Molecular Biology 2022Quote: ... Reverse transcription was performed using All-in-One 5X RT MasterMix (ABM, G592). Primer Express 3.0 software was used to design primers and qRT-PCR was performed as previously described (83,84 ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA was then synthesized using All-In-One RT MasterMix (Applied Biological Materials). qPCR was carried out using TB Green Premix Ex Taq II (Takara Bio ...
-
bioRxiv - Genetics 2020Quote: ... Reverse transcription was carried out using ‘5× All-in-one RT Mastermix’ (#g486; ABM), following the manufacturer instructions ...
-
bioRxiv - Cancer Biology 2021Quote: HKDC1 sgRNA CRISPR All-in-One Lentivirus (Human) (Cat No. 234181110603) was purchased from ABM and HepG2 cells (70% confluent ...
-
bioRxiv - Cancer Biology 2022Quote: ... three different CRISPR/Cas9 sgRNA designs in an all-in-one lentiviral vector (ABM, 382541140595) were purchased ...
-
bioRxiv - Microbiology 2020Quote: ... prior to cDNA synthesis using the 5X All-In-One Master mix (Applied Biological Materials), both according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... #K0663105) or Scrambled sgRNA CRISPR/Cas9 All-in-One Lentivector (#K010) from Applied Biological Materials were used to generate lentiviral supernatants that were transduced into TC71 or A673 cell lines followed by selection with 1 μg/ml puromycin ...
-
bioRxiv - Physiology 2020Quote: ... and audible baseline monitor (model ABM-3, WPI) as previously described27 ...
-
bioRxiv - Genomics 2020Quote: ... the First-strand cDNA was synthesized using a 5X All-In-One RT MasterMix (ABM, Canada). The relative quantification was done by ChamQTM Universal SYBR® qPCR Master Mix (Vazyme ...
-
bioRxiv - Immunology 2022Quote: ... One quarter of the total RNA sample was used as template for OneStep RT-PCR (ABM) using the following primers ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA was synthesized by reverse transcription using All-In-One 5X RT Master Mix (ABM-G592) following manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by preparation of cDNA using 5× All-In- One RT MasterMix (Applied Biological Materials Inc.) as per the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: Human ATG7 shRNA-GFP (5’-CAGTGGATCTAAATCTCAAACTGAT-3’) and scrambled control shRNA-GFP (5’-GGGTGAACTCACGTCAGAA −3’) lentiviral plasmids were purchased from Applied Biological Materials Inc ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 µL Cas9 Reaction Buffer (Applied Biological Materials Inc.), 7.5 µL 300 nM CpG-targeting in vitro transcribed gRNA or non-CpG-targeting control gRNA ...
-
bioRxiv - Genetics 2021Quote: ... Reverse transcription was performed using the ABM all-in-one 5X RT Mastermix kit (ABM, Richmond, Canada). Primer Express 3.0 software was used for designing primers and quantitative real-time polymerase chain reaction (qRT-PCR ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was reverse transcribed into first-strand cDNA using All-in-one RT MasterMix (Applied Biological Materials). qPCR of cDNA was then performed using P7/P8 primers (5249-5358) ...
-
bioRxiv - Plant Biology 2022Quote: ... before reverse transcription to cDNA using a 5×All-In-One RT MasterMix (Applied Biological Materials Inc.). PhnsLTP1 ...
-
bioRxiv - Genetics 2023Quote: ... Reverse transcription to generate cDNA was performed using the ABM All-In-One 5X RT MasterMix (ABM). Primer Express 3.0 software was used for designing primers for gene expression analysis by quantitative real-time polymerase chain reaction (Table S4) ...
-
bioRxiv - Neuroscience 2023Quote: ... The cDNA was synthesized from total RNA by using 5×All-In-One RT MasterMix (ABM, China) following the standard protocols ...
-
bioRxiv - Immunology 2020Quote: Lentiviral plasmids encoding shRNAs were obtained from Sigma-Aldrich and all-in-one vectors carrying CTNNB1 sgRNA/Cas9 with GFP reporter were obtained from Applied Biological Materials. Each plasmid was transformed into One Shot® Stbl3™ chemically competent cells (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was converted into cDNA using 5x ALL-In-One RT Master Mix (Applied Biological Materials Inc, G490) following the manufacturers’ instructions and diluted 20 times with nuclease-free H2O ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA was prepared by reverse transcription with All-in-One 5X RT MasterMix (G592, Applied Biological Materials Inc) with 1000ng RNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... The LSL-SAM insert from one bacterial colony was sequence-verified trough NGS denovo assembly (Applied Biological Materials Inc.), linearized through XhoI digestion and electroporated into G4 mES cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse St8sia1 sgRNA CRISPR/Cas9 All-in-One Lentivector (pLenti-U6-sgRNA-SFFV-Cas9-2A-Puro; #456551140595, Applied Biological Materials) with three target sequences Target 1-17 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cDNA was synthesized from the isolated RNA by reverse transcription using RevertAid™ first strand cDNA synthesis kit (5× All-In-One RT MasterMix, ABM) according to the manufacturer’s instructions in a RNase-free environment ...
-
bioRxiv - Microbiology 2020Quote: ... The cDNA was prepared from total RNA using the 5XAll-in-One MasterMix (with AccuRT Genomic DNA Removal Kit) (ABM, China). Levels of target genes were determined by Roche LightCycler 96 Real Time PCR Detection System with SYBR Green qPCR Master Mix (Biomake) ...
-
PI3K/HSCB axis facilitates FOG1 nuclear translocation to promote erythropoiesis and megakaryopoiesisbioRxiv - Molecular Biology 2024Quote: Total RNA was isolated from erythroid/megakaryocytic progenitor or K562 cells using the RNA Isolation Kit (Omn-02, Omiget, China) and reverse-transcribed into cDNA with the All-In-One 5X RT MasterMix (G592, ABM, Canada). For qRT-PCR ...
-
bioRxiv - Cancer Biology 2021Quote: ... The mRNA and miRNA reverse transcription were performed within a 5×All-In-One RT MasterMix kit (Applied Biological Materials, BC, Canada) and TaqMan microRNA Reverse Transcription Kit (Thermo Fisher ...
-
bioRxiv - Microbiology 2020Quote: ... One μg of total RNA was used to synthesize cDNA using 5XAll-in-One MasterMix (AccuRT Genomic DNA Removal Kit, ABM, Shanghai, China). The cDNA was used as template in qPCRs with primers Asafor /Asarev ...
-
bioRxiv - Molecular Biology 2020Quote: cDNA synthesis was carried out with isolated total RNA using 5 X All-In-One RT MasterMix kit (Applied Biological Materials, G490) according to manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: ... The cDNA was prepared from 100-200 ng of total RNA using 5xAll-In-One RT Master mix (Applied Biological Materials Inc). Real-time PCR was performed using Fast SYBR Green Master Mix ...
-
bioRxiv - Cancer Biology 2022Quote: ... CAV1 sgRNA CRISPR/Cas9 All-in-One Lentivector (pLenti-U6-sgRNA-SFFV-Cas9-2A-Puro) from Applied Biological Materials (Richmond, BC, Canada) was used to derive CAV1 KO cell lines ...
-
bioRxiv - Physiology 2020Quote: ... The cDNA was prepared from total RNA (50-100ng) with ABM 5x All-In-One RT Master Mix (G486, Applied Biological Materials Inc.). The cDNAs of SENP1 and cyclophilin A were amplified using preamplification primers and Platinum Taq DNA polymerase (10966-018 ...
-
bioRxiv - Neuroscience 2021Quote: ... up to a maximum of 4 runs (64 blocks - 32 ABM, 32 WM). The two distinct block types (ABM and WM ...
-
bioRxiv - Cancer Biology 2023Quote: ... in a pLenti-Puro vector (pLenti-All-in-one-U6-sgRNA human Zeb1 (target1) or scramble -SFFV-Cas9 nuclease-2A-Puro) (Applied Biological Materials Inc., Richmond, Canada). The sequences of the sgRNA targeting ZEB1 are the following ...
-
bioRxiv - Bioengineering 2021Quote: ... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
bioRxiv - Genomics 2021Quote: ... and PCR amplified using with a 5′-primer for mmu-miR-682 (CTGCAGTCACAGTGAAGTCTG) and the universal 3′ miRNA primer (Applied Biological Materials). Relative Ct values were calculated based on start-point samples and compared to the mid-(only for IL-KO ...
-
bioRxiv - Microbiology 2022Quote: ... syringae Lz4W was routinely grown at 22°C or 4°C (for optimum and low temperatures respectively) in Antarctic bacterial medium (ABM) composed of 5 g/l peptone and 2.0 g/l yeast extract ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were stained with primary antibodies for 16 hours at 4 °C using the following antibodies: anti-GFP (Applied Biological Materials, G096, 1:1000), anti mCherry (novus biologicals ...