Labshake search
Citations for Applied Biological Materials :
1 - 13 of 13 citations for 6H THIENO 2 3 B THIOPYRAN since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
bioRxiv - Physiology 2020Quote: ... and audible baseline monitor (model ABM-3, WPI) as previously described27 ...
-
bioRxiv - Cancer Biology 2020Quote: Human ATG7 shRNA-GFP (5’-CAGTGGATCTAAATCTCAAACTGAT-3’) and scrambled control shRNA-GFP (5’-GGGTGAACTCACGTCAGAA −3’) lentiviral plasmids were purchased from Applied Biological Materials Inc ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 µL Cas9 Reaction Buffer (Applied Biological Materials Inc.), 7.5 µL 300 nM CpG-targeting in vitro transcribed gRNA or non-CpG-targeting control gRNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... and human recombinant bFGF-2 (10ng/mL; ABM). DMEM-F12 w/o L-Glutamine w/o Hepes w/o Glucose (Biowest ...
-
bioRxiv - Genetics 2020Quote: ... and human recombinant bFGF-2 (10ng/mL; ABM). Cells were monitored for mycoplasma contamination using MycoAlert (Lonza ...
-
bioRxiv - Paleontology 2023Quote: The sample comprises Iron Age 2 Abel Beth Maacah (ABM, N=74); Iron Age 2 Tel Dor (Dor ...
-
bioRxiv - Genomics 2021Quote: ... and PCR amplified using with a 5′-primer for mmu-miR-682 (CTGCAGTCACAGTGAAGTCTG) and the universal 3′ miRNA primer (Applied Biological Materials). Relative Ct values were calculated based on start-point samples and compared to the mid-(only for IL-KO ...
-
bioRxiv - Genetics 2020Quote: ... The target genes were detected using a Brightgreen 2× qPCR Mastermix low-rox (#Mastermix-lr; ABM.). The details of the primers used in these assays are given in Supplementary Table 1 in the Supplementary Information.
-
bioRxiv - Neuroscience 2021Quote: The first cohort consisted of 14 participants that dynamically switched between a 2-back working memory (WM) task and an autobiographical memory (ABM) retrieval task ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 2 ug of RNA was treated with an AccuRT Genomic DNA Removal Kit (Applied Biological Materials, Richmond, BC, Canada) prior to cDNA synthesis using the 5X All-In-One Master mix (Applied Biological Materials) ...
-
bioRxiv - Cell Biology 2020Quote: Resist-coated silicon wafers were patterned with circles (Diameter: 1 µm; Center-to-center spacing: 2 µm) using 220 nm deep UV lithography (ABM, USA). Then ...
-
bioRxiv - Cell Biology 2024Quote: The levels of mRNA were measured by real-time qPCR using BlasTaq 2×qPCR master mix (Applied Biological Materials, Richmond, BC, Canada) with gene-specific primers (Table 1) ...