Labshake search
Citations for Applied Biological Materials :
1 - 28 of 28 citations for 6 methyl 4 oxo 5 6 dihydro 4H thieno 2 3 b thiopyran 2 sulfonyl chloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: Human ATG7 shRNA-GFP (5’-CAGTGGATCTAAATCTCAAACTGAT-3’) and scrambled control shRNA-GFP (5’-GGGTGAACTCACGTCAGAA −3’) lentiviral plasmids were purchased from Applied Biological Materials Inc ...
-
bioRxiv - Cancer Biology 2022Quote: ... and human recombinant bFGF-2 (10ng/mL; ABM). DMEM-F12 w/o L-Glutamine w/o Hepes w/o Glucose (Biowest ...
-
bioRxiv - Genetics 2020Quote: ... and human recombinant bFGF-2 (10ng/mL; ABM). Cells were monitored for mycoplasma contamination using MycoAlert (Lonza ...
-
bioRxiv - Paleontology 2023Quote: The sample comprises Iron Age 2 Abel Beth Maacah (ABM, N=74); Iron Age 2 Tel Dor (Dor ...
-
bioRxiv - Genetics 2020Quote: ... The target genes were detected using a Brightgreen 2× qPCR Mastermix low-rox (#Mastermix-lr; ABM.). The details of the primers used in these assays are given in Supplementary Table 1 in the Supplementary Information.
-
bioRxiv - Genomics 2021Quote: ... and PCR amplified using with a 5′-primer for mmu-miR-682 (CTGCAGTCACAGTGAAGTCTG) and the universal 3′ miRNA primer (Applied Biological Materials). Relative Ct values were calculated based on start-point samples and compared to the mid-(only for IL-KO ...
-
bioRxiv - Neuroscience 2021Quote: The first cohort consisted of 14 participants that dynamically switched between a 2-back working memory (WM) task and an autobiographical memory (ABM) retrieval task ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 2 ug of RNA was treated with an AccuRT Genomic DNA Removal Kit (Applied Biological Materials, Richmond, BC, Canada) prior to cDNA synthesis using the 5X All-In-One Master mix (Applied Biological Materials) ...
-
bioRxiv - Cell Biology 2020Quote: Resist-coated silicon wafers were patterned with circles (Diameter: 1 µm; Center-to-center spacing: 2 µm) using 220 nm deep UV lithography (ABM, USA). Then ...
-
bioRxiv - Cell Biology 2024Quote: The levels of mRNA were measured by real-time qPCR using BlasTaq 2×qPCR master mix (Applied Biological Materials, Richmond, BC, Canada) with gene-specific primers (Table 1) ...
-
bioRxiv - Physiology 2020Quote: ... and audible baseline monitor (model ABM-3, WPI) as previously described27 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 µL Cas9 Reaction Buffer (Applied Biological Materials Inc.), 7.5 µL 300 nM CpG-targeting in vitro transcribed gRNA or non-CpG-targeting control gRNA ...
-
bioRxiv - Neuroscience 2021Quote: ... up to a maximum of 4 runs (64 blocks - 32 ABM, 32 WM). The two distinct block types (ABM and WM ...
-
bioRxiv - Genetics 2020Quote: ... Reverse transcription was carried out using ‘5× All-in-one RT Mastermix’ (#g486; ABM), following the manufacturer instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by preparation of cDNA using 5× All-In- One RT MasterMix (Applied Biological Materials Inc.) as per the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... before reverse transcription to cDNA using a 5×All-In-One RT MasterMix (Applied Biological Materials Inc.). PhnsLTP1 ...
-
bioRxiv - Neuroscience 2023Quote: ... The cDNA was synthesized from total RNA by using 5×All-In-One RT MasterMix (ABM, China) following the standard protocols ...
-
bioRxiv - Microbiology 2022Quote: ... syringae Lz4W was routinely grown at 22°C or 4°C (for optimum and low temperatures respectively) in Antarctic bacterial medium (ABM) composed of 5 g/l peptone and 2.0 g/l yeast extract ...
-
bioRxiv - Microbiology 2020Quote: The recombinant adenovirus 5 expressing human ACE2 (Ad5-hACE2) and control adenovirus (Ad5-Ctrl) were purchased from ABM (Vancouver, Canada) or generated in the laboratory ...
-
bioRxiv - Cancer Biology 2022Quote: ... All cell lines were cultured in DMEM supplemented with 10% FBS and 100 units/mL penicillin/streptomycin under 5% CO2 at 37C and were routinely tested for mycoplasma contamination by ABM’s PCR Mycoplasma detection kit ...
-
bioRxiv - Cancer Biology 2024Quote: ... and were maintained in 100 units/mL penicillin/streptomycin under 5% CO2 at 37°C and routinely tested for mycoplasma contamination using the PCR Mycoplasma Detection Kit (ABM). Cells were cultured in the following media ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cDNA was synthesized from the isolated RNA by reverse transcription using RevertAid™ first strand cDNA synthesis kit (5× All-In-One RT MasterMix, ABM) according to the manufacturer’s instructions in a RNase-free environment ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were stained with primary antibodies for 16 hours at 4 °C using the following antibodies: anti-GFP (Applied Biological Materials, G096, 1:1000), anti mCherry (novus biologicals ...
-
bioRxiv - Neuroscience 2021Quote: E15 DRG neurons in microfluidic devices were transduced on DIV1 with 5-10µl AAV9-axonal-GCaMP6s- P2A-mRuby3 (Broussard et al., 2018) (AAV9 was generated by Applied Biological Materials, Canada) alone or together with 25µl lentivirus expressing shRNA targeting tGFP ...
-
bioRxiv - Cancer Biology 2021Quote: ... The mRNA and miRNA reverse transcription were performed within a 5×All-In-One RT MasterMix kit (Applied Biological Materials, BC, Canada) and TaqMan microRNA Reverse Transcription Kit (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2020Quote: cDNA synthesis was carried out with isolated total RNA using 5 X All-In-One RT MasterMix kit (Applied Biological Materials, G490) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: PAEC were transduced with adenoviral constructs encoding a constitutive active mutant of dual specificity mitogen-activated protein kinase 5 (caMEK5) (#000101A, Applied Biological Materials Inc); Flag-tagged KLF4 (#VH829440 ...