Labshake search
Citations for Applied Biological Materials :
1 - 5 of 5 citations for 6 ethylpyridine 3 boronic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2020Quote: ... and audible baseline monitor (model ABM-3, WPI) as previously described27 ...
-
bioRxiv - Cancer Biology 2020Quote: Human ATG7 shRNA-GFP (5’-CAGTGGATCTAAATCTCAAACTGAT-3’) and scrambled control shRNA-GFP (5’-GGGTGAACTCACGTCAGAA −3’) lentiviral plasmids were purchased from Applied Biological Materials Inc ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 µL Cas9 Reaction Buffer (Applied Biological Materials Inc.), 7.5 µL 300 nM CpG-targeting in vitro transcribed gRNA or non-CpG-targeting control gRNA ...
-
bioRxiv - Bioengineering 2021Quote: ... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
bioRxiv - Genomics 2021Quote: ... and PCR amplified using with a 5′-primer for mmu-miR-682 (CTGCAGTCACAGTGAAGTCTG) and the universal 3′ miRNA primer (Applied Biological Materials). Relative Ct values were calculated based on start-point samples and compared to the mid-(only for IL-KO ...