Labshake search
Citations for Applied Biological Materials :
1 - 34 of 34 citations for 6 ethoxy 1 2 3 4 tetrahydro 2 2 4 trimethylquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... and human recombinant bFGF-2 (10ng/mL; ABM). DMEM-F12 w/o L-Glutamine w/o Hepes w/o Glucose (Biowest ...
-
bioRxiv - Genetics 2020Quote: ... and human recombinant bFGF-2 (10ng/mL; ABM). Cells were monitored for mycoplasma contamination using MycoAlert (Lonza ...
-
bioRxiv - Paleontology 2023Quote: The sample comprises Iron Age 2 Abel Beth Maacah (ABM, N=74); Iron Age 2 Tel Dor (Dor ...
-
bioRxiv - Cell Biology 2020Quote: Resist-coated silicon wafers were patterned with circles (Diameter: 1 µm; Center-to-center spacing: 2 µm) using 220 nm deep UV lithography (ABM, USA). Then ...
-
bioRxiv - Genetics 2020Quote: ... The target genes were detected using a Brightgreen 2× qPCR Mastermix low-rox (#Mastermix-lr; ABM.). The details of the primers used in these assays are given in Supplementary Table 1 in the Supplementary Information.
-
bioRxiv - Neuroscience 2021Quote: The first cohort consisted of 14 participants that dynamically switched between a 2-back working memory (WM) task and an autobiographical memory (ABM) retrieval task ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 2 ug of RNA was treated with an AccuRT Genomic DNA Removal Kit (Applied Biological Materials, Richmond, BC, Canada) prior to cDNA synthesis using the 5X All-In-One Master mix (Applied Biological Materials) ...
-
bioRxiv - Cell Biology 2024Quote: The levels of mRNA were measured by real-time qPCR using BlasTaq 2×qPCR master mix (Applied Biological Materials, Richmond, BC, Canada) with gene-specific primers (Table 1) ...
-
bioRxiv - Neuroscience 2021Quote: ... up to a maximum of 4 runs (64 blocks - 32 ABM, 32 WM). The two distinct block types (ABM and WM ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were stained with primary antibodies for 16 hours at 4 °C using the following antibodies: anti-GFP (Applied Biological Materials, G096, 1:1000), anti mCherry (novus biologicals ...
-
bioRxiv - Microbiology 2022Quote: ... syringae Lz4W was routinely grown at 22°C or 4°C (for optimum and low temperatures respectively) in Antarctic bacterial medium (ABM) composed of 5 g/l peptone and 2.0 g/l yeast extract ...
-
bioRxiv - Physiology 2020Quote: ... and audible baseline monitor (model ABM-3, WPI) as previously described27 ...
-
bioRxiv - Cancer Biology 2020Quote: Human ATG7 shRNA-GFP (5’-CAGTGGATCTAAATCTCAAACTGAT-3’) and scrambled control shRNA-GFP (5’-GGGTGAACTCACGTCAGAA −3’) lentiviral plasmids were purchased from Applied Biological Materials Inc ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 µL Cas9 Reaction Buffer (Applied Biological Materials Inc.), 7.5 µL 300 nM CpG-targeting in vitro transcribed gRNA or non-CpG-targeting control gRNA ...
-
bioRxiv - Genomics 2021Quote: ... and PCR amplified using with a 5′-primer for mmu-miR-682 (CTGCAGTCACAGTGAAGTCTG) and the universal 3′ miRNA primer (Applied Biological Materials). Relative Ct values were calculated based on start-point samples and compared to the mid-(only for IL-KO ...
-
bioRxiv - Systems Biology 2022Quote: ... and 1% penicillin/streptomycin (ABM) and grown in a 5% CO2 humidified atmosphere at 37°C ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GAPDH (1:1000; Applied Biological Materials), mouse anti-GFP (1:1000 ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GFP (1:1000, Applied Biological Materials) and with rabbit or mouse-peroxidase secondary antibodies (1:10,000 ...
-
bioRxiv - Bioengineering 2023Quote: ... with 1% antibiotic-antimycotic solution (ABM, Thermo Fischer) on gelatin-coated (2% ...
-
bioRxiv - Cell Biology 2023Quote: ... and 1% (v/v) antibiotic/antimycotic solution (ABM; Gibco).
-
bioRxiv - Biochemistry 2023Quote: ... anti-HA Tag (Applied Biological Materials, #G166; 1:1000), anti-G6PD (Abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... chicken polyclonal antibodies to GFP (Applied Biological Materials G160, 1:1000); and human anti-ACA antibodies (Immunovision HCT-0100 ...
-
bioRxiv - Immunology 2023Quote: ... BlasTaq™ 2X qPCR MasterMix (ref. G892-1, Applied Biological Materials, Vancouver, Canada) and specific primers were used to assess gene transcripts expression for following targets ...
-
bioRxiv - Cell Biology 2019Quote: ... Membranes were stained with the following primary antibodies: rabbit anti-HA (1:4000; Applied Biological Materials, Richmond, Canada), mouse anti-GAPDH (1:1000 ...
-
bioRxiv - Neuroscience 2020Quote: ... Trans Genic Inc.) and HRP-conjugated goat anti-rabbit antibody (1:15 000 dilution, SH012; Applied Biological Materials). Chemiluminescence was detected using SuperSignal West Femto Max Sensitivity Substrate (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: The following primary antibodies were used for Western blotting: anti-His Tag (Applied Biological Materials, #G020; 1:4000), anti-HA Tag (Applied Biological Materials ...
-
bioRxiv - Cell Biology 2022Quote: Total cell lysates (RPE1, MC3T3) were isolated using RIPA buffer supplemented with 1:100 protease (Applied Biological Materials, G135). Mouse tissue disruption and homogenization was performed in RIPA buffer supplemented with 1:100 protease using Tissue Lyser LT (Qiagen) ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was synthesized from 1 μg RNA by using the OneScript® Plus cDNA Synthesis Kit (Applied Biological Materials Inc.). Gene-specific primers pairs (Table S1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... with an additional modification of a deletion of 1 adenosine in the 10-A polynucleotide sequence in exon 10 (codons 771-774) of the ATR cDNA sequence (Applied Biological Materials).
-
bioRxiv - Cell Biology 2023Quote: ... Mycoplasma negativity of the original cell lines (hTERT RPE-1 and 293T) grown in antibiotics-free media were confirmed by a PCR based test (G238, Applied Biological Materials).
-
bioRxiv - Cell Biology 2023Quote: ... Mycoplasma negativity of the original cell lines (hTERT RPE-1 and 293T) grown in antibiotics-free media were confirmed by a PCR based test (G238, Applied Biological Materials).
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... The cell suspension was then diluted in StemFlex with ROCK inhibitor to a concentration of 1e6 cell/mL and mixed with 50uL aliquots of both tetO-ALN-PuroR and pUBIQ-rtTA viruses tittered at an estimated 1 × 107 IU/mL using a qPCR Lentivirus Titration Kit (Applied Biological Materials, #LV900). hiPSCs were plated on Matrigel-coated plates and incubated at 37°C with virus overnight ...
-
bioRxiv - Bioengineering 2024Quote: ... Subsequently these layers were patterned into 1 cm x 10 or 20 µm strips via photolithography (ABM-USA, INC., Jan Jose, CA, USA) and a wet chemical etching of titanium and copper with copper etchant (Millipore Sigma ...