Labshake search
Citations for Bio-Rad :
151 - 200 of 5356 citations for N 5 Trimethoxysilyl 2 Aza 1 Oxopentyl Caprolactam since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Table 1) was performed at 4°C overnight at a 1:1000 dilution in 5% nonfat dry milk (Bio-Rad No. 1706404). Incubation of HRP conjugated secondary antibody (different species ...
-
bioRxiv - Developmental Biology 2023Quote: ... All cDNA samples were diluted 1:5 and 1 μL was used in quantitative PCR (qPCR) reactions with iTaq Universal SYBR Green Supermix (Bio-Rad, #1725124), according to manufacturer’s instruction and using the Applied Biosystems QuantStudio 7 flex qPCR System ...
-
bioRxiv - Cell Biology 2020Quote: ... X-ray film (Figs 1-5) and the ChemiDoc MP Imaging System (Bio-Rad, cat#17001402) (Supplemental Fig 3).
-
bioRxiv - Microbiology 2021Quote: ... Protein was applied at 1 ml/min to a 5 ml ceramic hydroxyapatite column (BioRad BioscaleTM) in the dialysis buffer ...
-
bioRxiv - Biophysics 2024Quote: ... and applied to a 5 mL prepacked Mini ceramic hydroxyapatite (CHT) type 1 column (Bio-Rad). The flowthrough was collected and purified by SEC using a HiLoad 16/600 Superdex 200 (Cytiva ...
-
bioRxiv - Neuroscience 2024Quote: ... the membranes were incubated with Tidyblot (diluted 1:5000 in 5% BSA in TBST, Biorad, USA), for 1 h ...
-
bioRxiv - Biochemistry 2020Quote: ... were incubated together at RT for 5 min in the presence and absence of 5 mM 2-OG prior to loading on the analytical ENrich 650 column (BioRad Laboratories, Inc., Hecules, USA). The column was equilibrated with 50 mM Tris/HCl and 150 mM NaCl and supplemented with 5 mM 2-oxoglutarate when the complexes were preincubated in the presence of 5 mM 2-oxoglutarate and the applied proteins isocratic eluted with the respective buffer with a flow rate of 1 ml min-1 ...
-
bioRxiv - Zoology 2020Quote: ... Samples were incubated in a 1:1 (w/v) ratio of 2× sample buffer (0.2M DTT, BioRad Laemmli Sample Buffer #1610737) at room temperature for 20 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... or anti-rat Ly-6B.2 alloantigen (1:100, MCA771GA, Bio-Rad Laboratories, Hercules, CA) for neutrophils ...
-
bioRxiv - Neuroscience 2020Quote: ... TBS-T) before incubation with HRP-conjugated secondary antibody for 2 hours (Biorad, 1:1000). After 3 times washes with 5 min intervals with TBS-T ...
-
Bacterial Polyphosphates Induce CXCL4 and Synergize with Complement Anaphylatoxin C5a in Lung InjurybioRxiv - Immunology 2022Quote: ... using 1-2 ng cDNA per sample complemented with iQ SYBR®Green Mastermix (BioRad) and specific forward and reverse primers at a concentration of 0.5 µM each ...
-
bioRxiv - Plant Biology 2021Quote: ... membranes were washed 3 times 5 min with washing solution and incubated 1 h with anti-rabbit IgG HRP-conjugated secondary antibodies (Bio-Rad, 1:3000) at room temperature ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... proteins were transferred onto a 0.45 μm nitrocellulose membrane (Bio-Rad, catalog n° 1620115) for 1 hour at RT at 100V ...
-
bioRxiv - Bioengineering 2021Quote: ... Samples for AFM imaging were purified by using the Freeze ‘N Squeeze kit (BioRad) according to the manufacturer’s protocol.
-
bioRxiv - Bioengineering 2024Quote: ... The samples were purified for TEM imaging using the Freeze ’N Squeeze (Bio-Rad) gel extraction column and imaging samples were prepared as previously described.
-
bioRxiv - Plant Biology 2022Quote: ... Images were taken by ChemiDoc™ MP Imaging System (Bio-Rad, Catalog N° #12003154).
-
bioRxiv - Bioengineering 2023Quote: ... Purification of DNA origami structures was performed by gel extraction (Freeze ‘N Squeeze, BioRad) or PEG precipitation (46) ...
-
bioRxiv - Biochemistry 2021Quote: ... Blots were then blocked for 1 h at 25 °C with 5% non-fat dry milk (BioRad) in TBST (50 mM Tris ...
-
bioRxiv - Neuroscience 2022Quote: ... and blocked for 1 h at room temperature in 5% skim milk (Catalog #170-6404, Bio-Rad). Primary antibody incubations were performed overnight at 4°C with antibodies diluted in TBS/0.1% Tween-20/5% BSA ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Synthesized cDNA was diluted 1:10 and 5 µl mixed with SsoAdvanced Universal Sybr Green supermix (Biorad). qPCR was performed using the Biorad CFX96 PCR machine ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies were diluted 1:1000 in PBS-T containing 5% blotting-grade blocker (Bio-Rad, #1706404). Membranes were incubated overnight (≈16 h) ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were incubated shaking for 1 hour at RT with 4% blocking solution (5% milk powder (BioRad) in TBS-T) ...
-
bioRxiv - Developmental Biology 2020Quote: ... We ran the qPCR reactions using 1-2 µl cDNA in SYBR Green Master Mix (Biorad) totaling 20 µl in a Biorad CFX96 machine using 60°C as the annealing temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... 2-3 μg of total protein were loaded onto 10% SDS-polyacrylamide (29:1 Bio-Rad) gels with 10 μM phostag reagent (FUJIFILM Wako Chemicals ...
-
bioRxiv - Biophysics 2020Quote: ... Nanodisc reconstitution was achieved by incubation with 0.5 - 1 mL Bio-Beads SM-2 (Bio-Rad) for 16 hours at 4°C under constant rotation ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were washed in monomer solution (1 x PBS, 2 M NaCl, 2.5% acrylamide (Bio-Rad), 0.15% Methylenbisacrylamide (Santa Cruz) ...
-
bioRxiv - Genetics 2022Quote: ... 1-2 μg RNA was used for cDNA synthesis using the iScript Advanced kit (Bio-Rad), following the manual.
-
bioRxiv - Microbiology 2022Quote: ... Commercial antibodies were used for β-tubulin (clone YL1/2, Bio-Rad, Watford, UK; 1:5000), β-actin (Abcam ab8227 ...
-
bioRxiv - Neuroscience 2024Quote: ... containing Factor 1 and Factor 2 at manufacturer- recommender concentrations (Bio-Rad, Hercules, CA; cat #171304011). Lung tissues were similarly homogenized in RIPA buffer (Thermo Fisher ...
-
bioRxiv - Immunology 2022Quote: ... diluted to 1:5,000 in 1X TBST 5% milk powder for 1 hour before visualisation with Clarity™ Western ECL Substrate (Bio-Rad, Hercules, California, US) using a Syngene G ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2020Quote: ... Biobeads SM-2 (Biorad; 2 g; prewashed in nanodisc buffer) were added ...
-
bioRxiv - Genomics 2020Quote: ... 2% CleanCut (BioRad) agarose was melted at 70°C then cooled to 50°C ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked in 5% BSA or 5% milk dissolved in TBS (Biorad) containing 0.1% Tween 20 (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... and finally TMB (3,3’, 5, 5’-tetramethylbenzidine) Core+ reagent (Bio-Rad cat # BUF062C) for development ...
-
bioRxiv - Biophysics 2022Quote: The purified proteins of V2HeR3 were reconstituted into a mixture of POPE and POPG membranes (molar ratio = 3:1) with a protein-to-lipid molar ratio of 1:20 by removing DDM using Bio-Beads (SM-2; Bio-Rad, CA, USA). The reconstituted samples were washed three times with 1 mM NaCl and 2 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Cell Biology 2024Quote: ... each lysate was diluted at a 1:1 ratio with a solution of 2× Laemmli sample buffer (#1610737EDU, Bio-Rad, Hercules, CA, USA), containing 5% (v/v ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were clarified by a brief centrifugation (10,000 g for 5 min at 4°C) and the supernatants were collected and diluted with 2× reducing Laemmeli buffer (Bio-Rad, Hercules, CA, USA, cat. #1610737). For preparation of cell culture lysates ...
-
bioRxiv - Cell Biology 2020Quote: ... TBST (50 mM Tris-HCl pH 7.4, 1% Triton X-100) with 5% non-fat milk (Bio-Rad) was used for blocking ...
-
bioRxiv - Genetics 2021Quote: ... Samples were then diluted 1:5 and placed into a 96 well plate with Supermix (no dUTPs, BioRad) and the required target locus primers and MGB-NFQ probes (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2021Quote: ... Complementary DNA (cDNA) was synthesized with 1-5 μg of RNA using iScript cDNA synthesis kit (Bio-Rad). mRNA levels were measured using qRT-PCR with SYBR Green Master Mix (BioRad) ...
-
bioRxiv - Microbiology 2021Quote: ... Immunohistochemistry was performed on paraffin sections (5 μm) using antibody F4-80 (Bio-rad, France; diluted 1:100). Sections were incubated overnight at 4°C ...
-
bioRxiv - Physiology 2021Quote: ... Membranes were blocked 1 hour in skim milk 5% TBS-Tween buffer (TBST, Bio-Rad, 0.05% Tween 20), and incubated overnight with the primary antibodies diluted in blocking buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were blocked for 1 h at room temperature with 5% non-fat dry milk (Bio-Rad Laboratories) in Tris-buffered saline (TBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... Membranes were blocked at room temperature for 1 hour in 5% nonfat dry milk (blocking grade, Bio-Rad) dissolved in Tris-buffered saline containing 0.1% Tween 20 (TBST) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mononucleosomal DNA was purified using agarose gel electrophoresis and Freeze N’ Squeeze Columns (BioRad, #7326166). As a spike-in control ...
-
bioRxiv - Microbiology 2020Quote: ... and transferred to Hybond N+ (Amersham Biosciences) membrane using a Trans-Blot Turbo system (Biorad). A denaturated DNA marker was used for size estimation.
-
bioRxiv - Biophysics 2020Quote: ... 0.5% n-dodecyl-β-D-maltoside using a Bio-Spin 6 desalting column (Bio-Rad). CmeC (5 μM ...
-
bioRxiv - Cell Biology 2022Quote: ... Supernatant was mixed with sample loading buffer supplemented with 1% v/v 2-mercaptoethanol (BioRad, Cat #1610710). Sample was not heated to prevent aggregation of the GPCR ...