Labshake search
Citations for Bio Basic :
1 - 25 of 25 citations for Rat CPS1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... The recombinant plasmids were isolated using plasmid purification kit (Bio Basic Canada) and the inserts were verified by sequencing (Genomed ...
-
bioRxiv - Biochemistry 2024Quote: ... The recombinant plasmids were isolated using plasmid purification kit (Bio Basic Canada) and the inserts were verified by sequencing (Genomed ...
-
bioRxiv - Microbiology 2023Quote: Plasmid DNA was extracted using the EZ-10 Spin Column Plasmid DNA Minipreps Kit (Bio Basic) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: Plasmid DNA was prepared using either the EZ-10 Spin Column Plasmid DNA Miniprep Kit (Bio Basic) or the QIAprep Spin Miniprep Kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... HP Plasmid Midiprep Kits (Bio Basic Inc, Canada). was used to isolate the plasmid ...
-
bioRxiv - Plant Biology 2021Quote: ... and plasmid DNA was extracted with the EZ-10 Spin Column Plasmid DNA Minipreps Kit (Bio Basic Inc., Markham, ON, Canada). The extracted destination vectors were confirmed by PCR with the primers T-35S-F (5’-AGGGTTTCTTATATGCTCAACACATG-3’ ...
-
bioRxiv - Plant Biology 2021Quote: ... and plasmid DNA was extracted with the EZ-10 Spin Column Plasmid DNA Minipreps Kit (Bio Basic Inc., Markham, ON, Canada). The extracted expression vectors were amplified by PCR with the primers 35S Promoter (5’-CTATCCTTCGCAAGACCCTTC-3’ ...
-
bioRxiv - Plant Biology 2021Quote: ... and plasmid DNA was extracted with the EZ-10 Spin Column Plasmid DNA Miniprep Kit (Bio Basic Inc., Markham, ON, Canada). The extracted entry vectors were confirmed by PCR with the primers M13-F (5’-GTAAAACGACGGCCAGT-3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... heat shock transformation was performed using Escherichia coli (DH5α) Plasmids were purified using EZ-10 Spin Column Plasmid DNA Miniprep Kit by (Bio Basic Inc). Correct gRNA insertion was confirmed by DNA sequencing.
-
bioRxiv - Plant Biology 2022Quote: ... White positive colonies were selected via blue-white screening and plasmid DNA were isolated using EZ-10 Spin Column Plasmid DNA Miniprep Kit (Bio Basic Asia, Singapore). Sequence information of all cloned vectors were confirmed with Sanger sequencing (Bio Basic Asia ...
-
bioRxiv - Bioengineering 2020Quote: ... The constructed plasmids were verified by sequencing (service provider: Bio Basic Asia Pacific Pte Ltd, Singapore). Each of the constructed plasmids was introduced into E ...
-
bioRxiv - Microbiology 2021Quote: ... The plasmids were extracted using a Miniprep kit according to the manufacturer’s recommendations (Bio Basic Inc.) and then transformed into E ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 S-expressing plasmids were codon-optimized and generated by gene synthesis (Bio Basic Asia Pacific) according to GenBank accession QHD43416.1 ...
-
bioRxiv - Biochemistry 2022Quote: The gene encoding SARS-CoV-2 2-170 NSP3 Mac1 was cloned into a pET-11a plasmid (Bio Basic) and transformed into E ...
-
bioRxiv - Microbiology 2021Quote: ... overnight cultures of SH100 and SH101 carrying or not plasmids pAG117 and pAG195 were diluted to OD600≈ 0.04 in M9 minimal media supplemented with 0.2 % Casaminoacids (Bio Basic Canada). Cultures were incubated at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... Expression plasmids (pcDNA3.1) encoding codon-optimised N genes at KpnI-BamHI sites referred to as pN were purchased from Bio Basic Inc ...
-
bioRxiv - Plant Biology 2021Quote: ... was inoculated in 5 mL of LB medium supplemented with rifampicin 10 μg/mL (#R0146, Duchefa), carbenicillin 50 μg/mL (#C0109, MELFORD) and the plasmid-specific selection antibiotic spectinomycin 100 μg/mL (#SB0901, Bio Basic). The pre-culture was incubated at 28°C for 2 days with shaking at 120 rpm ...
-
bioRxiv - Biochemistry 2022Quote: ... Escherichia coli BL21 Rosetta (DE3) cells harboring these plasmids were induced with 0.2 mM isopropyl β-D-1-thiogalactopyranoside (Bio Basic) for 16 hours at 16 °C ...
-
bioRxiv - Plant Biology 2022Quote: ... were inoculated in 5 ml of LB medium supplemented with rifampicin 15 μg/ml (#R0146, Duchefa), carbenicillin 50 μg/ml (#C0109, MELFORD) and the plasmid-specific selection antibiotic spectinomycin 100 μg/ml (#SB0901, Bio Basic). For the GV3101 strain preparation ...
-
bioRxiv - Bioengineering 2023Quote: ... The sequences of all the constructed plasmids were verified using Sanger sequencing (Service provider: Bio Basic Asia Pacific Pte Ltd, Singapore).
-
bioRxiv - Cell Biology 2021Quote: ... We synthesized the gene sequence for YPet-P2A-neoR (fig. S12) flanked by 900-950 bp homology arms into a pUC donor plasmid (Bio Basic Inc.) and targeted it to the endogenous p21 gene with the gRNA sequence ggaagccctaatccgcccac (Synthego) ...
-
bioRxiv - Microbiology 2023Quote: ... The second transfection was done with pJET-UL39R-GFP-p53-Ul39L plasmid supplemented with 10 ug/mL of puromycin (Bio Basic, Canada). After 48h ...
-
bioRxiv - Developmental Biology 2022Quote: ... A 950 bp fragment containing the 7s region was excised from the plasmid using XhoI and AsiSI sites and substituted by a 588 bp fragment (synthesized by Bio Basic USA, Inc.) containing the 7s truncated region ...
-
bioRxiv - Developmental Biology 2022Quote: ... A 2003 bp region containing the wild-type version of 552 Glycine was excised from the plasmid using AsiSI and EcoNI sites and substituted by a 2003 bp fragment (synthesised by Bio Basic USA, Inc.) containing the sequence for 552 Aspartic ...
-
bioRxiv - Cell Biology 2019Quote: ... Knock-out cell lines were used to prepare over-expression cell lines by transfection of a pcDNA3.1(-) plasmid expressing the complete human CasD1 cDNA open reading frame synthesized by Bio Basic (Markham, Ontario, Canada). Transfected cells were selected with G418 and single cell clones screened by staining with PToV-P4 HE-Fc to identify 9-O-Ac positive cell lines ...