Labshake search
Citations for Bio Basic :
1 - 30 of 30 citations for P N Nonylphenol Diethoxylate Ring 13C6 99% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... and resuspended in prewarmed 30°C 50 ml YPD supplemented with 50 ug/ml Pronase and 0.2M Hydroxyurea (Bio Basic HB0528). Cells were pelleted again ...
-
bioRxiv - Microbiology 2023Quote: ... The second transfection was done with pJET-UL39R-GFP-p53-Ul39L plasmid supplemented with 10 ug/mL of puromycin (Bio Basic, Canada). After 48h ...
-
bioRxiv - Immunology 2020Quote: ... Lm-OVA stocks frozen at −80 C were grown overnight at 37°C in BHI broth supplemented with 5 ug/ml Erythromycin (Bio Basic, Amherst, New York). Then ...
-
bioRxiv - Plant Biology 2022Quote: ... one to three colonies were inoculated in 5 ml of LB medium supplemented with rifampicin 50 μg/ml (#R0146, Duchefa), gentamicin 25 μg/ml (#G0124, Duchefa) and spectinomycin 100 μg/ml (#SB0901, Bio Basic). The pre- culture was incubated at 28°C for 2 days with shaking at 120 rpm.
-
bioRxiv - Plant Biology 2021Quote: ... was inoculated in 5 mL of LB medium supplemented with rifampicin 10 μg/mL (#R0146, Duchefa), carbenicillin 50 μg/mL (#C0109, MELFORD) and the plasmid-specific selection antibiotic spectinomycin 100 μg/mL (#SB0901, Bio Basic). The pre-culture was incubated at 28°C for 2 days with shaking at 120 rpm ...
-
bioRxiv - Plant Biology 2022Quote: ... were inoculated in 5 ml of LB medium supplemented with rifampicin 15 μg/ml (#R0146, Duchefa), carbenicillin 50 μg/ml (#C0109, MELFORD) and the plasmid-specific selection antibiotic spectinomycin 100 μg/ml (#SB0901, Bio Basic). For the GV3101 strain preparation ...
-
bioRxiv - Cell Biology 2021Quote: ... and N-acetyl-L-cysteine (NAC) (Bio Basic) were used as anti-oxidants ...
-
bioRxiv - Microbiology 2022Quote: ... A puc19 plasmid containing a RIX/NSP3-2A-P-His insert under the control of a T7 transcription promoter (puc19/T7/ RIX/NSP3-2A-P-His) was purchased from Bio Basic Canada Inc ...
-
bioRxiv - Bioengineering 2022Quote: ... and 0.3% Triton X-100 (Bio Basic) in DPBS ...
-
bioRxiv - Microbiology 2020Quote: ... Expression plasmids (pcDNA3.1) encoding codon-optimised N genes at KpnI-BamHI sites referred to as pN were purchased from Bio Basic Inc ...
-
bioRxiv - Biophysics 2021Quote: The gene encoding 419-residue SARS-CoV-2 N protein was purchased from a local company (Bio Basic Asia Pacific Pte Ltd), which was cloned into an expression vector pET-28a with a TEV protease cleavage site between N protein and N-terminal 6xHis-SUMO tag used to enhance the solubility ...
-
bioRxiv - Biophysics 2022Quote: The gene encoding 419-residue SARS-CoV-2 N protein was purchased from a local company (Bio Basic Asia Pacific Pte Ltd), which was cloned into an expression vector pET-28a with a TEV protease cleavage site between N protein and N-terminal 6xHis-SUMO tag used to enhance the solubility (10) ...
-
bioRxiv - Biochemistry 2024Quote: ... was assembled from two synthetic fragments as follows: the N terminal FEN domain of Taq polymerase (with an Asp141Lys mutation (Bio Basic Inc, Canada)) flanked by an EcoRI site and ribosomal binding site (GAATTCTAAAAAGGAGGAAAACAT ...
-
bioRxiv - Microbiology 2023Quote: ... 50 μg/ml Kanamycin (Bio Basic)) and grown at 37°C in a Multitron Standard incubator (Infors HT ...
-
bioRxiv - Microbiology 2021Quote: ... 50 µg mL−1 of kanamycin (Kan; Bio Basic).
-
bioRxiv - Biophysics 2022Quote: ... 0.004% CHS and 0.2 mg/ml Flag peptide (Bio Basic, USA). β- mercaptoethanol (βME ...
-
bioRxiv - Molecular Biology 2023Quote: ... selection was performed using 2 µg/ml of puromycin (Bio Basic) to collect cells expressing the desired shRNAs ...
-
bioRxiv - Cell Biology 2023Quote: ... Transformants were selected on TAP plates containing 20µg/ml hygromycin (Bio Basic). Clones expressing SIP protein were identified using whole mount transmission electron microscopy based on the restoration of mastigoneme rows on the ciliary surface ...
-
bioRxiv - Immunology 2024Quote: ... As substrate 1.0 mg/ ml o-phenylendiamine (OPD, Bio Basic Canada Inc) in 0.1 M citrate-phosphate buffer ...
-
bioRxiv - Microbiology 2022Quote: ... NaHCO3 or FBS but supplemented with 5 ng/mL IFN-γ (Bio Basic, USA), 400 ng/mL LPS (EMD Millipore ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... supplemented with 15 g/l agar and 50 µg/ml Kanamycin sulfate (Bio Basic KB-0286) at 37°C ...
-
bioRxiv - Microbiology 2020Quote: GM (2 mg/mL) solution was prepared using gentamicin sulfate of USP grade produced by BIO BASIC INC (Toronto ...
-
bioRxiv - Bioengineering 2023Quote: ... Macrophages were polarized to M1 with 50 ng/ml interferon gamma (hIFN-y, Bio Basic, RC217-17) and 50 ng/ml Lipopolysacharides (LPS ...
-
bioRxiv - Bioengineering 2023Quote: ... Microglia were polarized to M1 with 50 ng/ml interferon gamma (hIFN-y, Bio Basic, RC217-17) and 50 ng/ml Lipopolysacharides (LPS ...
-
bioRxiv - Bioengineering 2023Quote: ... Microglia were polarized to M2 with 50 ng/ml interleukin-4 (IL-4, Bio Basic, RC212-15-5) for 48 hours.
-
bioRxiv - Bioengineering 2023Quote: Macrophages were polarized to M2 with 50 ng/ml interleukin-4 (IL-4, Bio Basic, RC212-15-5) for 48 hours (Ext Fig 1B) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Its genomic DNA was extracted from an axenic 50 ml of culture using the Molecular Biology Kit (Bio Basic) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Strains expressing the RPB1 CTD WT or CTD mutant plasmids were grown in YNB medium lacking histidine to an OD600 of 0.5 and treated with 1 μg/mL of rapamycin (Bio Basic) for 90 min to anchor-away the endogenous Rpb1 protein ...
-
bioRxiv - Cell Biology 2021Quote: ... bacteria cells were spin down and suspended in buffer H (50 mM Tris-HCl pH 8.0, 150 mM NaCl, 10% Glycerol) containing 1 mg/ml lysozyme (Bio Basic, Cat. No. LDB0308-5) and 0.1 % TritonX-100 ...
-
bioRxiv - Biochemistry 2023Quote: ... Successful first cross-over transformants (blue colonies) were selected and screened on Hyg/Spec agar plates supplemented with 20 μg/ml X-gal (Bio Basic Asia Pacific, Singapore). A KanR episomal plasmid containing msmeg_0317 under the control of an acetamide-inducible promoter (pMyC-0317 ...