Labshake search
Citations for Bio Basic :
1 - 12 of 12 citations for L Phenylalanine N T Boc 13C9 97 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... and N-acetyl-L-cysteine (NAC) (Bio Basic) were used as anti-oxidants ...
-
bioRxiv - Plant Biology 2021Quote: The T-DNA inserts for each transformation construct were synthesized using a third-party vendor (Bio Basic) based on sequences published by Philips et al ...
-
bioRxiv - Bioengineering 2023Quote: ... L-tyrosine and M9 medium broth powder were purchased from Bio Basic Asia Pacific Pte Ltd ...
-
bioRxiv - Microbiology 2020Quote: ... Expression plasmids (pcDNA3.1) encoding codon-optimised N genes at KpnI-BamHI sites referred to as pN were purchased from Bio Basic Inc ...
-
bioRxiv - Microbiology 2021Quote: ... The plf gene cluster from strain QT598 (plfQT598) was amplified using primers CMD1847_F and CMD1900_R and cloned into vector pUCm-T (Bio Basic, Markham, Ontario, Canada), generating plasmid pIJ507 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... supplemented with 15 g/l agar and 50 µg/ml Kanamycin sulfate (Bio Basic KB-0286) at 37°C ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... The PCR products were recovered from agarose gels using a commercial kit (see above) and cloned using the TA vector pUCM-T vector (Bio Basic, Ontario, Canada) and transformed into TOP 10 competent cells (Invitrogen ...
-
bioRxiv - Biophysics 2021Quote: The gene encoding 419-residue SARS-CoV-2 N protein was purchased from a local company (Bio Basic Asia Pacific Pte Ltd), which was cloned into an expression vector pET-28a with a TEV protease cleavage site between N protein and N-terminal 6xHis-SUMO tag used to enhance the solubility ...
-
bioRxiv - Biophysics 2022Quote: The gene encoding 419-residue SARS-CoV-2 N protein was purchased from a local company (Bio Basic Asia Pacific Pte Ltd), which was cloned into an expression vector pET-28a with a TEV protease cleavage site between N protein and N-terminal 6xHis-SUMO tag used to enhance the solubility (10) ...
-
bioRxiv - Neuroscience 2023Quote: ... the drinking water of pregnant females was supplemented with 500 mg/l tetracycline (Bio Basic Canada, #TB0504) and 3% sucrose ...
-
bioRxiv - Biochemistry 2024Quote: ... was assembled from two synthetic fragments as follows: the N terminal FEN domain of Taq polymerase (with an Asp141Lys mutation (Bio Basic Inc, Canada)) flanked by an EcoRI site and ribosomal binding site (GAATTCTAAAAAGGAGGAAAACAT ...
-
bioRxiv - Plant Biology 2020Quote: ... containing a MS222 (Duchefa Biochemie, Reference: M0222.0010) half-strength medium pH 5.8 supplemented with 0.5 g/L MES (Bio Basic Canada Inc., Reference: MB0341), 1% (w/v ...