Labshake search
Citations for Bio Basic :
1 - 26 of 26 citations for 6 Chloro 9 3 N 2 chloroethyl ethylamino propylamino 2 methoxyacridine dihydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... alkaline phosphatase conjugated antibodies were detected colourometrically using BCIP/NBT (nitro-blue tetrazolium and 5- bromo-4-chloro-3’-indolyphosphate) Substrate Solution (#BE116.100ML; Bio Basic Canada Inc). For analysis of bands ...
-
bioRxiv - Biophysics 2021Quote: The gene encoding 419-residue SARS-CoV-2 N protein was purchased from a local company (Bio Basic Asia Pacific Pte Ltd), which was cloned into an expression vector pET-28a with a TEV protease cleavage site between N protein and N-terminal 6xHis-SUMO tag used to enhance the solubility ...
-
bioRxiv - Biophysics 2022Quote: The gene encoding 419-residue SARS-CoV-2 N protein was purchased from a local company (Bio Basic Asia Pacific Pte Ltd), which was cloned into an expression vector pET-28a with a TEV protease cleavage site between N protein and N-terminal 6xHis-SUMO tag used to enhance the solubility (10) ...
-
bioRxiv - Biochemistry 2022Quote: The gene encoding SARS-CoV-2 2-170 NSP3 Mac1 was cloned into a pET-11a plasmid (Bio Basic) and transformed into E ...
-
bioRxiv - Immunology 2024Quote: ... 1.5 mM MgCl2 and 2 mM MgSO4 (Bio Basic) in a total volume of 20 μL ...
-
bioRxiv - Bioengineering 2022Quote: ... and DNAse I (Bio Basic, #9003-98-9) at a final concentration of 0.04 U/mL and 100 µg/mL ...
-
bioRxiv - Molecular Biology 2023Quote: ... selection was performed using 2 µg/ml of puromycin (Bio Basic) to collect cells expressing the desired shRNAs ...
-
bioRxiv - Cell Biology 2021Quote: ... and N-acetyl-L-cysteine (NAC) (Bio Basic) were used as anti-oxidants ...
-
bioRxiv - Neuroscience 2022Quote: ... RT-qPCR was performed using Green-2-Go qPCR Master Mix (Bio Basic cat# QPCR004-S) with 25 ng cDNA per reaction and primers targeting mouse Sumo1 (NM_009460.2 ...
-
bioRxiv - Microbiology 2020Quote: GM (2 mg/mL) solution was prepared using gentamicin sulfate of USP grade produced by BIO BASIC INC (Toronto ...
-
bioRxiv - Evolutionary Biology 2023Quote: The wild-type (wt) VIM-2 gene including its signal peptide sequence was synthesized (Bio Basic Inc.) and subcloned into a low-copy number plasmid ...
-
bioRxiv - Neuroscience 2021Quote: ... Real-time quantitative PCR was performed using Green-2-Go qPCR Master Mix (Bio Basic cat# QPCR004-S) with 25 ng cDNA per reaction and primers targeting mouse Gapdh (Forward ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 S-expressing plasmids were codon-optimized and generated by gene synthesis (Bio Basic Asia Pacific) according to GenBank accession QHD43416.1 ...
-
bioRxiv - Microbiology 2020Quote: ... the entire genome sequence of SARS-CoV-2 USA/WA1/2020 (GenBank accession no. MN985325) was chemically synthesized (Bio Basic) in five fragments and cloned into pUC57 plasmids containing unique restriction sites ...
-
bioRxiv - Biophysics 2024Quote: ... The mutant ΔPAS EAG1 channel in pGH19 with the deletion of the PAS domain residues 2-130 was generated by Bio Basic Inc ...
-
bioRxiv - Microbiology 2021Quote: ... a set of overlapping cDNA fragments representing the entire genome of SARS-CoV-2 Wuhan isolate (GenBank: MN908947.3) were chemically synthesized and cloned into pUC57-Kan (Bio Basic Canada Inc). Where appropriate the relevant synthetic cDNA fragment carried the mutation D614G or Y453F + D614G in the viral S gene ...
-
bioRxiv - Immunology 2023Quote: ... The tumor cell suspension was filtered (100µm) and red blood cells were lysed using 0.83% NH4Cl (Bio Basic; CAS #12125-02-9) for 5 min at RT ...
-
bioRxiv - Molecular Biology 2020Quote: ... Forward primer LCHV-MEP93-qF: 5’-GTACTTCATCGCCTACGGAGC-3’ and reverse primer LCHV-MEP93-qR: 5’-TACGTGTGCTTGAGGAGGTC-3’ were synthesized from Bio Basic, Canada ...
-
bioRxiv - Cell Biology 2022Quote: ... 3% low-melting point agarose (Bio Basic, catalog # AB0015) was prepared in modified L-15 media and cooled to 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... Expression plasmids (pcDNA3.1) encoding codon-optimised N genes at KpnI-BamHI sites referred to as pN were purchased from Bio Basic Inc ...
-
bioRxiv - Cancer Biology 2024Quote: Blocking Solution: 3% Albumin Fraction V (Bio Basic; CA#9048-46-8), 0.1% Tween20 (ACP Chemicals ...
-
bioRxiv - Biochemistry 2024Quote: ... was assembled from two synthetic fragments as follows: the N terminal FEN domain of Taq polymerase (with an Asp141Lys mutation (Bio Basic Inc, Canada)) flanked by an EcoRI site and ribosomal binding site (GAATTCTAAAAAGGAGGAAAACAT ...
-
bioRxiv - Cancer Biology 2024Quote: ... Citric acid monohydrate (CAS# 5949-29-1) and sodium citrate (CAS# 6132-04-3) from Bio basic Canada Inc ...
-
bioRxiv - Biophysics 2021Quote: 6-well cell culture plates (Cell Star, Cat. -No. 657 160) were prepared by melting agarose (purchased from Bio Basic Canada Inc.; AB0015) pouring 3 mL into each well ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5’-GCG GGG ATC AAA TGT CGT TTT G-3’ yielding an amplicon of 135 bp (Fig. S1) were synthesized by Bio Basic Inc ...
-
bioRxiv - Biochemistry 2020Quote: The plasmid containing the monomer of a 145 bp of telomeric DNA (5′-ATC-(TTAGGG)23TGAT-3′) flanked by EcoRV and AvaI sites was obtained from Bio Basic Asia Pacific Pte Ltd ...