Labshake search
Citations for Bio Basic :
1 - 50 of 50 citations for 6 Chloro 2 4 chlorophenyl N N dimethylimidazo 1 2 α pyridine 3 methanamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: The gene encoding 419-residue SARS-CoV-2 N protein was purchased from a local company (Bio Basic Asia Pacific Pte Ltd), which was cloned into an expression vector pET-28a with a TEV protease cleavage site between N protein and N-terminal 6xHis-SUMO tag used to enhance the solubility ...
-
bioRxiv - Biophysics 2022Quote: The gene encoding 419-residue SARS-CoV-2 N protein was purchased from a local company (Bio Basic Asia Pacific Pte Ltd), which was cloned into an expression vector pET-28a with a TEV protease cleavage site between N protein and N-terminal 6xHis-SUMO tag used to enhance the solubility (10) ...
-
bioRxiv - Cell Biology 2023Quote: ... alkaline phosphatase conjugated antibodies were detected colourometrically using BCIP/NBT (nitro-blue tetrazolium and 5- bromo-4-chloro-3’-indolyphosphate) Substrate Solution (#BE116.100ML; Bio Basic Canada Inc). For analysis of bands ...
-
bioRxiv - Cell Biology 2021Quote: ... and N-acetyl-L-cysteine (NAC) (Bio Basic) were used as anti-oxidants ...
-
bioRxiv - Microbiology 2020Quote: ... Expression plasmids (pcDNA3.1) encoding codon-optimised N genes at KpnI-BamHI sites referred to as pN were purchased from Bio Basic Inc ...
-
bioRxiv - Biochemistry 2022Quote: The gene encoding SARS-CoV-2 2-170 NSP3 Mac1 was cloned into a pET-11a plasmid (Bio Basic) and transformed into E ...
-
bioRxiv - Biochemistry 2024Quote: ... was assembled from two synthetic fragments as follows: the N terminal FEN domain of Taq polymerase (with an Asp141Lys mutation (Bio Basic Inc, Canada)) flanked by an EcoRI site and ribosomal binding site (GAATTCTAAAAAGGAGGAAAACAT ...
-
bioRxiv - Immunology 2024Quote: ... 1.5 mM MgCl2 and 2 mM MgSO4 (Bio Basic) in a total volume of 20 μL ...
-
bioRxiv - Molecular Biology 2023Quote: ... selection was performed using 2 µg/ml of puromycin (Bio Basic) to collect cells expressing the desired shRNAs ...
-
bioRxiv - Neuroscience 2022Quote: ... RT-qPCR was performed using Green-2-Go qPCR Master Mix (Bio Basic cat# QPCR004-S) with 25 ng cDNA per reaction and primers targeting mouse Sumo1 (NM_009460.2 ...
-
bioRxiv - Microbiology 2020Quote: GM (2 mg/mL) solution was prepared using gentamicin sulfate of USP grade produced by BIO BASIC INC (Toronto ...
-
bioRxiv - Evolutionary Biology 2023Quote: The wild-type (wt) VIM-2 gene including its signal peptide sequence was synthesized (Bio Basic Inc.) and subcloned into a low-copy number plasmid ...
-
bioRxiv - Neuroscience 2021Quote: ... Real-time quantitative PCR was performed using Green-2-Go qPCR Master Mix (Bio Basic cat# QPCR004-S) with 25 ng cDNA per reaction and primers targeting mouse Gapdh (Forward ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 S-expressing plasmids were codon-optimized and generated by gene synthesis (Bio Basic Asia Pacific) according to GenBank accession QHD43416.1 ...
-
bioRxiv - Microbiology 2020Quote: ... the entire genome sequence of SARS-CoV-2 USA/WA1/2020 (GenBank accession no. MN985325) was chemically synthesized (Bio Basic) in five fragments and cloned into pUC57 plasmids containing unique restriction sites ...
-
bioRxiv - Cancer Biology 2024Quote: ... Citric acid monohydrate (CAS# 5949-29-1) and sodium citrate (CAS# 6132-04-3) from Bio basic Canada Inc ...
-
bioRxiv - Biophysics 2024Quote: ... The mutant ΔPAS EAG1 channel in pGH19 with the deletion of the PAS domain residues 2-130 was generated by Bio Basic Inc ...
-
bioRxiv - Microbiology 2021Quote: ... a set of overlapping cDNA fragments representing the entire genome of SARS-CoV-2 Wuhan isolate (GenBank: MN908947.3) were chemically synthesized and cloned into pUC57-Kan (Bio Basic Canada Inc). Where appropriate the relevant synthetic cDNA fragment carried the mutation D614G or Y453F + D614G in the viral S gene ...
-
bioRxiv - Molecular Biology 2020Quote: ... Forward primer LCHV-MEP93-qF: 5’-GTACTTCATCGCCTACGGAGC-3’ and reverse primer LCHV-MEP93-qR: 5’-TACGTGTGCTTGAGGAGGTC-3’ were synthesized from Bio Basic, Canada ...
-
bioRxiv - Bioengineering 2023Quote: ... Microglia were polarized to M2 with 50 ng/ml interleukin-4 (IL-4, Bio Basic, RC212-15-5) for 48 hours.
-
bioRxiv - Bioengineering 2023Quote: Macrophages were polarized to M2 with 50 ng/ml interleukin-4 (IL-4, Bio Basic, RC212-15-5) for 48 hours (Ext Fig 1B) ...
-
bioRxiv - Cell Biology 2022Quote: ... 3% low-melting point agarose (Bio Basic, catalog # AB0015) was prepared in modified L-15 media and cooled to 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: Blocking Solution: 3% Albumin Fraction V (Bio Basic; CA#9048-46-8), 0.1% Tween20 (ACP Chemicals ...
-
bioRxiv - Microbiology 2023Quote: ... all in the MM medium (carbon sources are purchased from Sigma-Aldrich with the exception of α-ketoglutaric acid purchased from Bio Basic). For the assay with salt ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... They were fixed in 4% paraformaldehyde for 24 h (Bio Basic, Markham, Ontario, Canada), decalcified in 10% EDTA-disodium salt for 6–8 weeks (Kelong ...
-
bioRxiv - Genetics 2020Quote: ... and were then fixed using perilymphatic perfusion with 4% paraformaldehyde (PFA) (Bio Basic Inc.,) prepared in phosphate-buffered saline (PBS) ...
-
bioRxiv - Biophysics 2021Quote: 6-well cell culture plates (Cell Star, Cat. -No. 657 160) were prepared by melting agarose (purchased from Bio Basic Canada Inc.; AB0015) pouring 3 mL into each well ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5’-GCG GGG ATC AAA TGT CGT TTT G-3’ yielding an amplicon of 135 bp (Fig. S1) were synthesized by Bio Basic Inc ...
-
bioRxiv - Biochemistry 2020Quote: The plasmid containing the monomer of a 145 bp of telomeric DNA (5′-ATC-(TTAGGG)23TGAT-3′) flanked by EcoRV and AvaI sites was obtained from Bio Basic Asia Pacific Pte Ltd ...
-
bioRxiv - Biochemistry 2020Quote: Genomic DNA was isolated using the Bio Basic All-4-One Genomic DNA MiniPrep Kit flowing the manufacturer’s protocol including the RNase treatment (Bio Basic Inc., Markham ON, Canada). The region around the CRISPR PREX1 target site was PCR-amplified using the primer pair DPREX3F (5’-GCACAGAGGGAAAGTCTCGG-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... source 1 agar (BIO BASIC, FB0010), source 2 Agar (Sangon Biotech ...
-
bioRxiv - Molecular Biology 2021Quote: ... supplemented with 1/10 volume of 1.5M Tris-HCl pH 8.8 (Tris Base Fisher BP152-5, Hydrochloric Acid Fisher A144-212) and 1/10 volume 1 M DTT (Bio Basic DB0058). Samples were boiled for 5 minutes before an additional centrifugation at 4 °C at 16,000 x g for 4 minutes.
-
bioRxiv - Microbiology 2021Quote: ... 50 µg mL−1 of kanamycin (Kan; Bio Basic).
-
bioRxiv - Molecular Biology 2022Quote: ... or 1 mM MTX (Bio Basic Inc, Cat# MB0612) was added where relevant and the sample preheated at 37°C for 2 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... covered with a 1% agar pad (Agar A, Bio Basic, FB0010 ...
-
bioRxiv - Cell Biology 2022Quote: ... Yeast strains were grown in YPD (1% yeast extract (Bio Basic), 2% peptone (BD Biosciences ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 140 mM NaCl (SB0476-1; Bio Basic, Markham, Ontario, Canada) in ddH2O] for 1 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1% sodium dodecyl sulfate (SDS) and 4X Denhardt’s solution (Bio Basic D0062)] ...
-
bioRxiv - Microbiology 2023Quote: ... traNAhD4-1 and traNAQU1 were chemically synthesized and obtained from Bio Basic. sfx94 ...
-
bioRxiv - Cell Biology 2024Quote: ... and then adding 1mM IPTG (Bio Basic item number 367-93-1) for 4 hours at 37°C with shaking ...
-
bioRxiv - Systems Biology 2020Quote: ... Protein production was then induced by the addition of 1 mM IPTG (Bio Basic) and incubation at 16°C overnight with agitation ...
-
bioRxiv - Molecular Biology 2020Quote: ... Strains expressing the RPB1 CTD WT or CTD mutant plasmids were grown in YNB medium lacking histidine to an OD600 of 0.5 and treated with 1 μg/mL of rapamycin (Bio Basic) for 90 min to anchor-away the endogenous Rpb1 protein ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were incubated for 60 min at 37°C with 10 pg µl-1 of RNase A (Bio Basic, Toronto, Canada). RNase activity was inactivated by adding 100 unites of Protector RNase Inhibitor (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... Escherichia coli BL21 Rosetta (DE3) cells harboring these plasmids were induced with 0.2 mM isopropyl β-D-1-thiogalactopyranoside (Bio Basic) for 16 hours at 16 °C ...
-
bioRxiv - Biochemistry 2023Quote: A plasmid for bacterial expression of human ARL15 (1-204) was obtained by cloning codon-optimized synthetic DNA into the NdeI and BamHI cloning sites of pET15b (Bio Basic). A truncated construct (residues 32-197 ...
-
bioRxiv - Plant Biology 2019Quote: ... The target loci were amplified by PCR using specific primers (Supplementary Table 1) and resulting DNA fragments were purified with PCR purification kit (Bio Basic Inc, Canada). The wsl5 and zebra3 PCR product was digested with SacI and SalI ...
-
bioRxiv - Zoology 2020Quote: Total RNA was isolated from 1×106 Xela DS2 or Xela VS2 cells using the EZ-10 Spin Column Total RNA Minipreps Super Kit (Bio Basic Canada Inc.) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... bacteria cells were spin down and suspended in buffer H (50 mM Tris-HCl pH 8.0, 150 mM NaCl, 10% Glycerol) containing 1 mg/ml lysozyme (Bio Basic, Cat. No. LDB0308-5) and 0.1 % TritonX-100 ...
-
bioRxiv - Bioengineering 2023Quote: ... in 1x annealing buffer (5 mM Tris, 1 mM EDTA, 5 mM MgCl, Millipore, cat# 648311-1KG, Bio Basic, cat# SD8135, Bio Basic, cat# MRB0328) and placed into the thermocycler ...
-
bioRxiv - Bioengineering 2023Quote: ... were mixed with ssDNA output oligonucleotides of interest at 2x excess (Table S1) in 1x annealing buffer (5 mM Tris, 1 mM EDTA, 5 mM MgCl, Millipore, cat# 648311-1KG, Bio Basic, cat# SD8135, Bio Basic, cat# MRB0328) and placed into the thermocycler ...