Labshake search
Citations for GeneCopoeia :
1 - 49 of 49 citations for Thioredoxin Domain Containing Protein 3 TXNDC3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... HA tagged hNHE6.2-FL and Cytoplasmic domain (CD) were cloned by GeneCopoeia. hNHE1-HA (3X on c-terminal ...
-
bioRxiv - Bioengineering 2019Quote: ... was PCR-amplified and fused to the extracellular domain of mouse FcγRI (GeneCopoeia, Rockville, MD) via overlap PCR amplification ...
-
bioRxiv - Cell Biology 2020Quote: Cells were transfected with the firefly luciferase-expressing (pEZX-MT05) plasmids containing the 3′UTR of BIM or an empty vector (Genecopoeia) and were co-transfected with miR-24-3p mimic ...
-
bioRxiv - Neuroscience 2020Quote: ... REST overexpression was performed by transducing DRG neurons with lentiviral constructs containing either REST (Lv135-REST) or humanized luciferase protein (Lv135-hLuc) as a control driven by the CMV promoter (GeneCopoeia). DRG neurons were replated 7 days after the viral infection ...
-
bioRxiv - Immunology 2021Quote: ... containing mouse CD4-eYFP (GeneCopoeia), into a pcDNA3.1 tGFP-P2A-mCherry vector ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were cotransfected with human PRNP 3’UTR miRNA Target Clone (pEZX-3’UTR-PRNP vector from Genecopoeia) and hsa-miR-519a-3p miRCURY LNA miRNA Mimic or its related Negative Control miRCURY LNA miRNA Mimic (Qiagen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... A vector without cMYC 3’UTR (GeneCopoeia) was used as experimental control ...
-
bioRxiv - Cancer Biology 2023Quote: ... sh-C (5’-TAATACGACTCACTATAGGG-3’; HSH096566-LVRU6GP-c); sh-E (5’-TAATACGACTCACTATAGGG-3’; HSH096566-LVRU6GP-e) or with the scrambled control (CSHCTR001-LVRU6GP, Genecopoeia), and the following packaging vectors ...
-
bioRxiv - Cancer Biology 2023Quote: ... lentiviral particles containing full length of either DUSP1 (Genecopoeia) or DUSP6 (Addgene #27975 ...
-
bioRxiv - Cancer Biology 2021Quote: ... or FGFR1-3’UTR target plasmid (HmiT005432-MT06; GeneCopoeia) was co-transfected with 50 nM NCm or miR-22m into 293T cells using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Immunology 2022Quote: ... Biotinylation of A33 protein was performed by using the biotin-protein ligase kit (GeneCopoeia™, B1001) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... or containing the cDNA for human MGP (EX-Z9471-Lv122; GeneCopoeia), and the following packaging vectors ...
-
bioRxiv - Molecular Biology 2024Quote: ... or miRNA 3’ UTR target control plasmid (CmiT000001-MT06-GC, GeneCopoeia) and 100nM of either miRIDIAN miRNA mimic of mmu-miR-532 (C-310769-01-0002 ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: Construct containing full-length human TOP2A cDNA sequence were purchased from Genecopoeia. Site-directed mutagenesis were conducted using QuikChange Site-Directed Mutagenesis Kit (Agilent) ...
-
bioRxiv - Neuroscience 2022Quote: ... and Grp94 (MCP230394-CG12-3-B) were obtained from Genecopoeia (Rockville, MD). The DNA was amplified using standard molecular biology approaches ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and M protein (YP_009724393.1) tagged at the C-terminus with green fluorescent protein (Ex-NV225-M03) were from GeneCopoeia (Rockland, MD, U.S.A). The control plasmid was pCMV-3Tag-3A (pCMV ...
-
bioRxiv - Neuroscience 2020Quote: ... or ORF expression clone containing N terminally tagged FLAG-SLC25A1 (GeneCopoeia, EX-A1932-Lv1020GS). The stably transfected cell lines were selectively maintained in media containing DMEM supplemented with 10% FBS ...
-
bioRxiv - Cell Biology 2023Quote: ... Amplified vector DNA (Cloned 3’UTR human Angptl4 (Endofectin GeneCopoeia catalog no. EF013-S) and miRNA 3’UTR (MmiT088761-MT06-264ng/ul ...
-
bioRxiv - Cell Biology 2020Quote: ... Most of the lysosomal membrane protein overexpression plasmids were purchased from GeneCopoeia. The CDS of RNF152 was purchased from Horizon Discovery ...
-
bioRxiv - Genetics 2019Quote: ... A pDONR entry clone containing the human rhodopsin cDNA sequence was purchased (GeneCopoeia #GC-T1321, Rockville, MD). Each of the 210 RHO variants was created via site-directed mutagenesis using a one-primer modification to the QuikChange II protocol from Agilent.((Braman ...
-
bioRxiv - Developmental Biology 2022Quote: ... HUVECs were transfected with 1μg of pcDNA3 plasmid vector containing a full-length mouse Vegfr3 cDNA (GeneCopoeia), or with empty vector (Martucciello et al. ...
-
bioRxiv - Cell Biology 2019Quote: HEK-293T cells were transfected with a transfer plasmid (pReceiver-Lv215) containing ZEB1 cDNA of transcript variant 2 (NM_030751.5) (GeneCopoeia) and a 3rd-generation packaging system ...
-
bioRxiv - Cell Biology 2019Quote: ... containing an sgRNA targeting TCGACAGCCTTATGGCGGAC in the mouse PFN1 gene and the puromycin donor plasmid pDonor-D01 (Genecopoeia) for selection ...
-
bioRxiv - Immunology 2024Quote: ... as well as a TSHR vector containing GFP and a puromycin resistance gene (Genecopoeia Inc., Rockville, MD, USA). These cells were then cultured in selection media containing either hygromycin (1 µg/mL ...
-
bioRxiv - Cancer Biology 2020Quote: The long and short 3’UTRs cloned into the dual-luciferase vector miTarget vector was obtained from GeneCopoeia. HCT116 cells were plated on 6-well plates and transfected with 50ng of each plasmid ...
-
bioRxiv - Cell Biology 2020Quote: Plasmid DNA was extracted from a miRNA 3’UTR target clone for ALK1 (HmiT022834-MT06, GeneCopoeia, MD, USA) using Qiagen Plasmid Midi Kit (Qiagen ...
-
bioRxiv - Bioengineering 2020Quote: Lentifect™ custom lentivirus encoding for MDR1 (human ABCB1, transcript variant 3, accession version: NM_000927.4) and a puromycin-resistant gene was prepared by Genecopoeia. Transduction was performed according to the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2022Quote: ... NGN2_GFP (NEUROG2) lentivirus was transduced as previously described at MOI 3 (GeneCopoeia cat#LPP-T7381-Lv103-A00-S). At the one-week time point NGN2_GFP+/oTau - and NGN2_GFP-/oTau + asteroids were mixed and placed in 96-well culture as previously described ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were co-transfected with 100ng of murine Gria1 3’ UTR renilla/luciferase plasmid (MmiT076857-MT06-GC, GeneCopoeia) or miRNA 3’ UTR target control plasmid (CmiT000001-MT06-GC ...
-
bioRxiv - Immunology 2023Quote: ... Lentiviral particles expressing CCL2-CXCL9 fusion protein and negative control were purchased from GeneCopoeia.
-
bioRxiv - Microbiology 2020Quote: ... and the control VSV-G protein pseudotyped Lentivirus (HLUC-Lv201 Firefly luciferase − eGFP lentifect-GeneCopoeia) at a concentration of 4,9E−9 GC/mL and 1,2E−9 GC/mL ...
-
bioRxiv - Biophysics 2020Quote: Plasmids encoding C-terminal eGFP-labeled full-length human LIM proteins were purchased from GeneCopoeia in the m98 vector ...
-
bioRxiv - Cancer Biology 2019Quote: Luciferase reporter plasmids containing the Wee1 mRNA3’-UTR (HmiT054534-MT06) or the Chk1 mRNA3’-UTR (HmiT061994-MT06) were purchased from GeneCopoeia. Twenty four hours before transfection ...
-
bioRxiv - Cell Biology 2022Quote: The expression construct for full-length human CEMIP (Uniprot ID: Q8WUJ3) containing a FLAG tag at the C-terminus in pReceiver-M39 was purchased from GeneCopoeia. HEK293 expressing the SV40 large T antigen were cultured in DMEM/F12 with 10% FBS ...
-
bioRxiv - Cell Biology 2021Quote: ... WT and SIRT1 KO E14 mESCs were generated by CRISPR/Cas9 mediated gene editing technology using lentivirus carrying either all-in-one empty vector pCRISPR-CG01 vector or pCRISPR-CG01 containing different sgRNAs targeting mouse Sirt1 gene (GeneCopoeia). Stable single colonies were picked up and screened with immunoblotting assay using anti-SIRT1 antibodies ...
-
bioRxiv - Cell Biology 2022Quote: ... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
bioRxiv - Molecular Biology 2023Quote: Full length wild Cacna2d2-3’UTR was cloned downstream of a Gaussia luciferase reporter gene in the pEZX-MT05 vector (GeneCopoeia). Site-directed mutagenesis was used to introduce mutations into the putative miR-423-5p binding sites on the Cacna2d2 3’UTR using the QuickChange II XL site-direct mutagenesis kit (Agilent ...
-
bioRxiv - Developmental Biology 2022Quote: ... C3H10T1/2 mesenchymal cells were transfected by the LUC-3’UTR without or with co-transfection of miR27a (MmiR3347-MR04-50, GeneCopoeia) using Lipofectamine 200 (Cat #11668027 ...
-
bioRxiv - Cancer Biology 2023Quote: ... To generate stable HD-PTP knockdown cell lines we transduced SW1573 and H1299 cells with 3 individual HD-PTP shRNAs (LPP-HSH067569-LVRH1GH) and control lentiviral particles (Scramble, LPP-CSHCTR001-LVRH1GH) (GeneCopoeia). Cells were selected with hygromycin and the strongest HD-PTP shRNA knockdown was used for the remaining experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... were used to perform in vitro miR-519a-3p target analysis on 3’UTR-PRNP reporter construct (vector pEZX-MT06, Genecopoeia). Cells were maintained in Advanced Dulbecco’s modified Eagle’s medium (AdDMEM ...
-
bioRxiv - Cell Biology 2022Quote: Stable cell lines expressing FLAG-tagged SLC25A1 were prepared by transfecting human neuroblastoma SH-SY5Y cells (ATCC, CRL-2266; RRID:CVCL_0019) with ORF expression clone containing N terminally tagged FLAG-SLC25A1 (GeneCopoeia, EX-A1932-Lv1020GS) (Gokhale et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... Two μg of the construct containing mS29 was transfected to the HEK293T mS29-KO cell line using 5 μL of EndoFectin™ Max (GeneCopoeia) pre-incubated in Opti-MEM (ThermoFisher) ...
-
bioRxiv - Cell Biology 2022Quote: ... The viral vector was based on a commercially-available pEZX-LvPM02 lentiviral construct containing the myogenin promoter (MPRM15676-LvPM02, Genecopoeia, Rockville, MD). The plasmid map can be found in Supplementary Fig ...
-
bioRxiv - Cell Biology 2021Quote: ... (catalogue number: HCP215394-CG04-3) and scrambled sgRNA control for pCRISPR-CG04 (catalogue number: CCPCTR01-CG04-B) were purchased from GeneCopoeia (Rockville, MD). The plasmid DNAs were transformed and amplified in Mix & Go Competent Cells-Strain HB 101 (Zymo Research ...
-
bioRxiv - Neuroscience 2021Quote: ... The shRNA target sequence that gave maximum knockdown efficiency of rat PRG-1 was 5′-GCAAGAACGAGAGTCGCAAGA-3′ and was obtained from GeneCopoeia (Rockville, MD, #RSH090356). Human PRG-1 obtained from DNASU Plasmid Repository (The Biodesign Institute/Arizona State University ...
-
bioRxiv - Cancer Biology 2019Quote: The bacterial expression vectors pReceiver-B11 for His-NSMCE2 and His-PFDN2 recombinant protein expression were purchased from Genecopoeia, Inc (Rockville ...
-
bioRxiv - Biochemistry 2023Quote: Lenti-SARS-CoV-2 Full Length Spike protein-pseudotyped (WT) and ACE2+ 293 cell lines were purchased from Genecopoeia. Viruses were produced as recommended by the manufacturer and harbored a luciferase expressing plasmid ...
-
bioRxiv - Cell Biology 2022Quote: Lentiviral shRNA against HCAR1 targeting 3’UTR regions of the gene (shHCAR1a: GCTTTATTTCAGGCCGAATGA; shHCAR1b: GCTCTGACCTTCTTCAAATCT) and the scrambled shRNA were purchased from GeneCopoeia (Cat# LPP-HSH007585-LVRU6MP-100). Targeting the 3’UTR regions allowed us to use our previous plasmid constructs for rescue experiments.
-
bioRxiv - Cell Biology 2023Quote: ... The secondary fluorescent antibodies was Goat anti rabbit (1:1000, L114A, GeneCopoeia, United States). Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole ...