Labshake search
Citations for GeneCopoeia :
1 - 17 of 17 citations for Suppressor of CDC2 With RNA Binding Motif 2 RBMS1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... cells were incubated in 2 μg/mL 4′,6-diamidino-2-phenylindole (DAPI, GeneCopoeia, C002) in PBS for 5 min at RT ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were then infected with SARS-CoV-2 Spike-Pseudotyped Lentivirus (Firefly Luciferase SARS-CoV-2 lentiviral particles-GeneCopoeia) and the control VSV-G protein pseudotyped Lentivirus (HLUC-Lv201 Firefly luciferase − eGFP lentifect-GeneCopoeia ...
-
bioRxiv - Microbiology 2023Quote: ... using All-in-oneTM 2× qPCR mix (GeneCopoeia) with specific VACV primers against the C11 gene ...
-
bioRxiv - Microbiology 2023Quote: ... with an All-in-one 2×qPCR mix (GeneCopoeia) and primers specific for VACV genome ...
-
bioRxiv - Immunology 2022Quote: The SARS-CoV-2 pseudovirus assay was performed by Genecopoeia as previously described47 ...
-
bioRxiv - Cancer Biology 2020Quote: ... USA) and guide RNA plasmids were obtained from Genecopoeia (Rockville, MD, USA). The transfected 293T cells were maintained in culture for 48-72 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... a solution was prepared by adding 2 drops of EasyProbe-Hoechst 33342 Live Cell Stain (GeneCopoeia) into 1 ml of M9 buffer ...
-
bioRxiv - Cell Biology 2019Quote: HEK-293T cells were transfected with a transfer plasmid (pReceiver-Lv215) containing ZEB1 cDNA of transcript variant 2 (NM_030751.5) (GeneCopoeia) and a 3rd-generation packaging system ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA levels were quantified using the Blaze Taq one-step SYBR Green RT-qPCR kit (GeneCopoeia, QP070) according to the manufacturer’s protocol and acquired on the ROCHE Lightcycler-96 system ...
-
bioRxiv - Cell Biology 2023Quote: ... The secondary fluorescent antibodies was Goat anti rabbit (1:1000, L114A, GeneCopoeia, United States). Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole ...
-
bioRxiv - Biochemistry 2023Quote: Lenti-SARS-CoV-2 Full Length Spike protein-pseudotyped (WT) and ACE2+ 293 cell lines were purchased from Genecopoeia. Viruses were produced as recommended by the manufacturer and harbored a luciferase expressing plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... Plasmids were introduced at 2 ng/μl of each (emerin shRNA, HSH095287-LVRU6MH; shRNA scramble sequence, CSHCTR001-LVRU6MH; Genecopoeia). For both methods ...
-
bioRxiv - Molecular Biology 2020Quote: ... we targeted exon 2 of NSUN6 with wild type Cas9 (pSpCAs9(BB)2A-GFP) plus the recombination vector pD07 (Genecopoeia) carrying the selection genes puromycin and eGFP under control of EIF1a promoter and with homology arms on Introns 1 and 2 ...
-
bioRxiv - Cell Biology 2022Quote: ... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
bioRxiv - Cell Biology 2019Quote: ... Lentiviral particle concentration was further determined by qPCR assessment of lentiviral RNA according to the manufacturer’s instructions (Lenti-Pac titration kit; LT005; GeneCopoeia).
-
bioRxiv - Molecular Biology 2020Quote: ... The total RNA was reverse-transcribed to cDNA using a high capacity cDNA Reverse Transcription Kit from GeneCopoeia (Maryland, USA). qRT-PCR was carried out to evaluate the syndecan-4 expression between lenti-synd4 shRNA and lenti-null group with SYBP Premix Ex Taq TM from Takara (Shiga ...
-
bioRxiv - Neuroscience 2021Quote: The short hairpin RNA targeting the murine expression of KMO (NM_133809.1) was designed and acquired from Genecopoeia (plasmid reference MSH037508-CU6). The in vivo transfection was performed using InVivo JetPei reagent (Polyplus ...