Labshake search
Citations for GeneCopoeia :
1 - 31 of 31 citations for Proteasome Subunit Beta Type 3 PSMB3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Beta) and Brazil B.1.1.28.1/P.1 (EX-CoV245-M39-GS, Gamma) vectors were obtained from GeneCopoeia. The mutants N501Y ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were cotransfected with human PRNP 3’UTR miRNA Target Clone (pEZX-3’UTR-PRNP vector from Genecopoeia) and hsa-miR-519a-3p miRCURY LNA miRNA Mimic or its related Negative Control miRCURY LNA miRNA Mimic (Qiagen) ...
-
bioRxiv - Genetics 2019Quote: Tagged human wild-type mRNAs cloned into a CMV promoted expression vector were obtained from GeneCopoeia. The ORFs of AFF3 and AFF4 were inserted in pEZ-M13 vector with a C-terminal FLAG tag ...
-
bioRxiv - Cancer Biology 2020Quote: ... A vector without cMYC 3’UTR (GeneCopoeia) was used as experimental control ...
-
bioRxiv - Cancer Biology 2023Quote: ... sh-C (5’-TAATACGACTCACTATAGGG-3’; HSH096566-LVRU6GP-c); sh-E (5’-TAATACGACTCACTATAGGG-3’; HSH096566-LVRU6GP-e) or with the scrambled control (CSHCTR001-LVRU6GP, Genecopoeia), and the following packaging vectors ...
-
bioRxiv - Cancer Biology 2021Quote: ... or FGFR1-3’UTR target plasmid (HmiT005432-MT06; GeneCopoeia) was co-transfected with 50 nM NCm or miR-22m into 293T cells using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: ... was amplified by PCR using a purchased plasmid encoding a complete Homo sapiens Dicer1 ribonuclease type III sequence (PubMed, NM_030621) (GeneCopoeia). In the case of PPC variants ...
-
bioRxiv - Neuroscience 2022Quote: ... The mutant sequence or wild-type sequence of HDAC6 were respectively cloned on the overexpression plasmid vector Lv206 (GeneCopoeia) (Fig EV5B) ...
-
bioRxiv - Molecular Biology 2020Quote: ... we targeted exon 2 of NSUN6 with wild type Cas9 (pSpCAs9(BB)2A-GFP) plus the recombination vector pD07 (Genecopoeia) carrying the selection genes puromycin and eGFP under control of EIF1a promoter and with homology arms on Introns 1 and 2 ...
-
bioRxiv - Neuroscience 2020Quote: ... To upregulate NMDAR expression in a cell-type-specific manner, mouse GluN1 cDNA (OMu21895D, Genescript) and mouse GluN2B cDNA (EX-Mm24581-M02, Genecopoeia) were cloned to custom-made vectors ...
-
bioRxiv - Biochemistry 2020Quote: MIN6 cells were grown to ∼50% confluency in 100 mm dishes and then batch transfected with 1 µg of wild type pre-miR-200c (MmiR-3304-MR04, Genecopoeia) or mutant pre-miR-200c (Synthesized by Genscript ...
-
bioRxiv - Genetics 2022Quote: 3x Flag- and GFP-tagged expression plasmids were used to express human CIDEC wild type (WT) and the CIDEC rare variants (E186X, V47I, Y61H, V161M, or Q220H) (Genecopoeia, Inc.). GFP-and mCherry-tagged plasmids were used to express human PLIN1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... or miRNA 3’ UTR target control plasmid (CmiT000001-MT06-GC, GeneCopoeia) and 100nM of either miRIDIAN miRNA mimic of mmu-miR-532 (C-310769-01-0002 ...
-
bioRxiv - Molecular Biology 2024Quote: ... was amplified by PCR using a purchased plasmid encoding a complete Homo sapiens Dicer1 ribonuclease type III sequence (PubMed, NM_030621) (GeneCopoeia, Rockville, MD, USA). The obtained fragment was cloned into pMCSG7 vector (courtesy of Laboratory of Protein Engineering ...
-
bioRxiv - Neuroscience 2022Quote: ... and Grp94 (MCP230394-CG12-3-B) were obtained from Genecopoeia (Rockville, MD). The DNA was amplified using standard molecular biology approaches ...
-
bioRxiv - Cell Biology 2023Quote: ... Amplified vector DNA (Cloned 3’UTR human Angptl4 (Endofectin GeneCopoeia catalog no. EF013-S) and miRNA 3’UTR (MmiT088761-MT06-264ng/ul ...
-
bioRxiv - Cancer Biology 2020Quote: The long and short 3’UTRs cloned into the dual-luciferase vector miTarget vector was obtained from GeneCopoeia. HCT116 cells were plated on 6-well plates and transfected with 50ng of each plasmid ...
-
bioRxiv - Cell Biology 2020Quote: Plasmid DNA was extracted from a miRNA 3’UTR target clone for ALK1 (HmiT022834-MT06, GeneCopoeia, MD, USA) using Qiagen Plasmid Midi Kit (Qiagen ...
-
bioRxiv - Bioengineering 2020Quote: Lentifect™ custom lentivirus encoding for MDR1 (human ABCB1, transcript variant 3, accession version: NM_000927.4) and a puromycin-resistant gene was prepared by Genecopoeia. Transduction was performed according to the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2022Quote: ... NGN2_GFP (NEUROG2) lentivirus was transduced as previously described at MOI 3 (GeneCopoeia cat#LPP-T7381-Lv103-A00-S). At the one-week time point NGN2_GFP+/oTau - and NGN2_GFP-/oTau + asteroids were mixed and placed in 96-well culture as previously described ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were co-transfected with 100ng of murine Gria1 3’ UTR renilla/luciferase plasmid (MmiT076857-MT06-GC, GeneCopoeia) or miRNA 3’ UTR target control plasmid (CmiT000001-MT06-GC ...
-
bioRxiv - Cell Biology 2022Quote: ... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
bioRxiv - Cell Biology 2020Quote: Cells were transfected with the firefly luciferase-expressing (pEZX-MT05) plasmids containing the 3′UTR of BIM or an empty vector (Genecopoeia) and were co-transfected with miR-24-3p mimic ...
-
bioRxiv - Molecular Biology 2023Quote: Full length wild Cacna2d2-3’UTR was cloned downstream of a Gaussia luciferase reporter gene in the pEZX-MT05 vector (GeneCopoeia). Site-directed mutagenesis was used to introduce mutations into the putative miR-423-5p binding sites on the Cacna2d2 3’UTR using the QuickChange II XL site-direct mutagenesis kit (Agilent ...
-
bioRxiv - Developmental Biology 2022Quote: ... C3H10T1/2 mesenchymal cells were transfected by the LUC-3’UTR without or with co-transfection of miR27a (MmiR3347-MR04-50, GeneCopoeia) using Lipofectamine 200 (Cat #11668027 ...
-
bioRxiv - Cancer Biology 2023Quote: ... To generate stable HD-PTP knockdown cell lines we transduced SW1573 and H1299 cells with 3 individual HD-PTP shRNAs (LPP-HSH067569-LVRH1GH) and control lentiviral particles (Scramble, LPP-CSHCTR001-LVRH1GH) (GeneCopoeia). Cells were selected with hygromycin and the strongest HD-PTP shRNA knockdown was used for the remaining experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... were used to perform in vitro miR-519a-3p target analysis on 3’UTR-PRNP reporter construct (vector pEZX-MT06, Genecopoeia). Cells were maintained in Advanced Dulbecco’s modified Eagle’s medium (AdDMEM ...
-
bioRxiv - Cell Biology 2021Quote: ... (catalogue number: HCP215394-CG04-3) and scrambled sgRNA control for pCRISPR-CG04 (catalogue number: CCPCTR01-CG04-B) were purchased from GeneCopoeia (Rockville, MD). The plasmid DNAs were transformed and amplified in Mix & Go Competent Cells-Strain HB 101 (Zymo Research ...
-
bioRxiv - Neuroscience 2021Quote: ... The shRNA target sequence that gave maximum knockdown efficiency of rat PRG-1 was 5′-GCAAGAACGAGAGTCGCAAGA-3′ and was obtained from GeneCopoeia (Rockville, MD, #RSH090356). Human PRG-1 obtained from DNASU Plasmid Repository (The Biodesign Institute/Arizona State University ...
-
bioRxiv - Cell Biology 2022Quote: Lentiviral shRNA against HCAR1 targeting 3’UTR regions of the gene (shHCAR1a: GCTTTATTTCAGGCCGAATGA; shHCAR1b: GCTCTGACCTTCTTCAAATCT) and the scrambled shRNA were purchased from GeneCopoeia (Cat# LPP-HSH007585-LVRU6MP-100). Targeting the 3’UTR regions allowed us to use our previous plasmid constructs for rescue experiments.
-
bioRxiv - Cell Biology 2023Quote: ... The secondary fluorescent antibodies was Goat anti rabbit (1:1000, L114A, GeneCopoeia, United States). Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole ...