Labshake search
Citations for GeneCopoeia :
1 - 33 of 33 citations for Mouse Anti Hepatitis C Virus NS5b Antibody 1825 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: AAVPrime™ Adeno-associated virus (AAV) Serotype Testing Kit (GeneCopoeia) was used to determine the efficiency of 8 different AAV serotypes in infecting the HCC1187 cell line ...
-
bioRxiv - Cancer Biology 2022Quote: ... shCtrl (CSHCTR001LVRU6GP) and shGJB6 Lenti-virus vector (HSH06069132LVRU6GP) were purchased from GeneCopoeia.
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... TBX21 and GATA3 or control virus particles contained the pReceiver-LV201 vector and were obtained from GeneCopoeia. A CMV promoter was used to drive the RORC ...
-
bioRxiv - Cell Biology 2023Quote: ... The secondary fluorescent antibodies was Goat anti rabbit (1:1000, L114A, GeneCopoeia, United States). Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole ...
-
bioRxiv - Systems Biology 2023Quote: ... Plasmids were packaged into 3rd generation replication deficient lenti-virus in HEK-293T cells using the Lenti-Pac HIV Expression Packaging Kit (Genecopoeia, Rockville, Maryland, USA) following manufacturer’s protocol (Cat# LT001).
-
bioRxiv - Immunology 2021Quote: ... containing mouse CD4-eYFP (GeneCopoeia), into a pcDNA3.1 tGFP-P2A-mCherry vector ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primers for mouse Sprr1a (GeneCopoeia, MQP028278) and human Sprr1a (GeneCopoeia ...
-
bioRxiv - Neuroscience 2020Quote: ... To upregulate NMDAR expression in a cell-type-specific manner, mouse GluN1 cDNA (OMu21895D, Genescript) and mouse GluN2B cDNA (EX-Mm24581-M02, Genecopoeia) were cloned to custom-made vectors ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmid pCMV-SPORT6-Rab11a (mouse) was purchased from GeneCopoeia Inc ...
-
bioRxiv - Cell Biology 2022Quote: ... and C-terminal MYC tag was placed in front of human NPHP3 (GeneCopoeia GC-H2370). All mutations to replace the lipidated cysteine with alanine were made using PCR mutagenesis (Weiner et al. ...
-
bioRxiv - Biophysics 2020Quote: Plasmids encoding C-terminal eGFP-labeled full-length human LIM proteins were purchased from GeneCopoeia in the m98 vector ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-FLAG (Genecopoeia) and anti-KDEL (Enzo Life Sciences ...
-
bioRxiv - Systems Biology 2021Quote: ... and pShuttle Gateway PLUS ORF Clone for mouse CCN4 (GC-Mm21303, GeneCopoeia). Lentiviruses were packaged as described (33 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pShuttle Gateway PLUS ORF Clone for mouse CCN4 (GC-Mm21303, GeneCopoeia). Lentiviruses were packaged as described (11 ...
-
bioRxiv - Neuroscience 2021Quote: ... a commercial plasmid encoding full-length mouse LAG3 CDS (GeneCopoeia, Mm0357-02) was used as standard ...
-
bioRxiv - Microbiology 2021Quote: ... McLellan) with a removable C-terminal twin-strep tag was transfected into cells with EndoFectin Max (GeneCopoeia) using the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... human or mouse LAG3 cDNA sequence (GeneCopoeia #EX-Z5714-M02 and #EX-Mm03576-M02) were inserted into an autoregulatory ...
-
bioRxiv - Cancer Biology 2023Quote: ... MT-5 cell line were also transduced to stably express luciferase using LentifectTM (GeneCopoeia #LPP-HLUC-Lv105-025-C) lentiviral vectors of firefly luciferase ...
-
bioRxiv - Bioengineering 2019Quote: ... was PCR-amplified and fused to the extracellular domain of mouse FcγRI (GeneCopoeia, Rockville, MD) via overlap PCR amplification ...
-
bioRxiv - Neuroscience 2020Quote: ... The plasmids used were mouse full length GSAP with HA tag (EX-Mm30424-M07, Genecopoeia), human GSAP-16k with HA tag (a.a ...
-
bioRxiv - Cell Biology 2022Quote: The expression construct for full-length human CEMIP (Uniprot ID: Q8WUJ3) containing a FLAG tag at the C-terminus in pReceiver-M39 was purchased from GeneCopoeia. HEK293 expressing the SV40 large T antigen were cultured in DMEM/F12 with 10% FBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... sh-C (5’-TAATACGACTCACTATAGGG-3’; HSH096566-LVRU6GP-c); sh-E (5’-TAATACGACTCACTATAGGG-3’; HSH096566-LVRU6GP-e) or with the scrambled control (CSHCTR001-LVRU6GP, Genecopoeia), and the following packaging vectors ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: cDNAs cloned and inserted into pReceiver-M03 vector driven by CMV promoter with c-terminal GFP were purchased from Genecopoeia (Alox12 ...
-
bioRxiv - Immunology 2021Quote: The lentiviral shRNA vector set targeting mouse Vcan (NM_019389.2) and scrambled control were purchased from GeneCopoeia (#MSH080253-LVRU6H and #CSHCTR001-LVRU6H) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and M protein (YP_009724393.1) tagged at the C-terminus with green fluorescent protein (Ex-NV225-M03) were from GeneCopoeia (Rockland, MD, U.S.A). The control plasmid was pCMV-3Tag-3A (pCMV ...
-
bioRxiv - Developmental Biology 2022Quote: ... HUVECs were transfected with 1μg of pcDNA3 plasmid vector containing a full-length mouse Vegfr3 cDNA (GeneCopoeia), or with empty vector (Martucciello et al. ...
-
bioRxiv - Neuroscience 2022Quote: The cDNAs of mouse PS Synthase I (PtdSSI, PSSI) and II (PtdSSII, PSSII) were obtained from GeneCopoeia, Inc ...
-
bioRxiv - Physiology 2020Quote: ... The mouse variant of IRAG in pReceiver-M61 was purchased from GeneCopoeia (Rockville, MD; Cat. #EX-Mm30453-M61). All HCN4 experiments were performed in stable cell lines ...
-
bioRxiv - Cell Biology 2019Quote: ... containing an sgRNA targeting TCGACAGCCTTATGGCGGAC in the mouse PFN1 gene and the puromycin donor plasmid pDonor-D01 (Genecopoeia) for selection ...
-
bioRxiv - Cell Biology 2021Quote: ... WT and SIRT1 KO E14 mESCs were generated by CRISPR/Cas9 mediated gene editing technology using lentivirus carrying either all-in-one empty vector pCRISPR-CG01 vector or pCRISPR-CG01 containing different sgRNAs targeting mouse Sirt1 gene (GeneCopoeia). Stable single colonies were picked up and screened with immunoblotting assay using anti-SIRT1 antibodies ...
-
bioRxiv - Genomics 2020Quote: ... ESCs were co-transfected with a plasmid expressing the Cas9 proteins and the sgRNA guide sequence targeting the Rosa26 locus (Genome CRISPR™ mouse ROSA26 safe harbor gene knock-in kit, SH054, GeneCopoeia) and the HDR repair template plasmid containing either H2B-Dam or H2B-Dam-NoLS constructs flanked by the homology arms with a molar ratio of 1:3.
-
bioRxiv - Developmental Biology 2022Quote: ESCs were co-transfected with a plasmid expressing Cas9 protein and the sgRNA guide sequence targeting the Rosa26 locus (Genome CRISPR™ mouse ROSA26 safe harbor gene knock-in kit, SH054, GeneCopoeia) and the HDR repair template plasmid containing HA-FLAG-Pramel7WT and - PRAMEL7ΔN sequences under the CAG promoter ...
-
bioRxiv - Cancer Biology 2023Quote: ... with 10 μg of the following anti-FOXM1 shRNA from Genecopoeia: sh-C (5’-TAATACGACTCACTATAGGG-3’ ...