Labshake search
Citations for GeneCopoeia :
1 - 34 of 34 citations for Mouse Anti Dengue Pan Envelope Protein Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... envelope (pMD2.G) and packaging (psPAX2) plasmids were amplified in Escherichia coli (GCI-L3, GeneCopoeia) and silica column purified (Qiagen Maxiprep ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... envelope (pMD2.G) and packaging (psPAX2) plasmids were amplified in Escherichia coli (GCI-L3, GeneCopoeia) and purified via silica column (Qiagen Maxiprep ...
-
bioRxiv - Cell Biology 2019Quote: ... the packaging plasmid (psPAX2) and the envelope plasmid (pMD2.G) were amplified in E.coli (GCI-L3; GeneCopoeia), and purified with a silica column (Qiagen Maxiprep) ...
-
bioRxiv - Cancer Biology 2020Quote: ... lentivirus particles were made using HEK293 cells (ATCC) transfected with 2nd generation packaging/envelope plasmids (Dr. Yasuhiro Ikeda, Mayo Clinic) and shRNA clones (GeneCopoeia). U251 cells were obtained from American Type Cell Culture and maintained for in vitro experiments in DMEM supplemented with 10% FBS and 1% Antibiotic Antimycotic Solution ...
-
bioRxiv - Cell Biology 2023Quote: ... The secondary fluorescent antibodies was Goat anti rabbit (1:1000, L114A, GeneCopoeia, United States). Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole ...
-
bioRxiv - Immunology 2021Quote: ... containing mouse CD4-eYFP (GeneCopoeia), into a pcDNA3.1 tGFP-P2A-mCherry vector ...
-
bioRxiv - Immunology 2022Quote: ... Biotinylation of A33 protein was performed by using the biotin-protein ligase kit (GeneCopoeia™, B1001) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... Primers for mouse Sprr1a (GeneCopoeia, MQP028278) and human Sprr1a (GeneCopoeia ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and M protein (YP_009724393.1) tagged at the C-terminus with green fluorescent protein (Ex-NV225-M03) were from GeneCopoeia (Rockland, MD, U.S.A). The control plasmid was pCMV-3Tag-3A (pCMV ...
-
bioRxiv - Neuroscience 2020Quote: ... To upregulate NMDAR expression in a cell-type-specific manner, mouse GluN1 cDNA (OMu21895D, Genescript) and mouse GluN2B cDNA (EX-Mm24581-M02, Genecopoeia) were cloned to custom-made vectors ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmid pCMV-SPORT6-Rab11a (mouse) was purchased from GeneCopoeia Inc ...
-
bioRxiv - Cell Biology 2020Quote: ... Most of the lysosomal membrane protein overexpression plasmids were purchased from GeneCopoeia. The CDS of RNF152 was purchased from Horizon Discovery ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-FLAG (Genecopoeia) and anti-KDEL (Enzo Life Sciences ...
-
bioRxiv - Systems Biology 2021Quote: ... and pShuttle Gateway PLUS ORF Clone for mouse CCN4 (GC-Mm21303, GeneCopoeia). Lentiviruses were packaged as described (33 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pShuttle Gateway PLUS ORF Clone for mouse CCN4 (GC-Mm21303, GeneCopoeia). Lentiviruses were packaged as described (11 ...
-
bioRxiv - Neuroscience 2021Quote: ... a commercial plasmid encoding full-length mouse LAG3 CDS (GeneCopoeia, Mm0357-02) was used as standard ...
-
bioRxiv - Immunology 2023Quote: ... Lentiviral particles expressing CCL2-CXCL9 fusion protein and negative control were purchased from GeneCopoeia.
-
bioRxiv - Neuroscience 2021Quote: ... human or mouse LAG3 cDNA sequence (GeneCopoeia #EX-Z5714-M02 and #EX-Mm03576-M02) were inserted into an autoregulatory ...
-
bioRxiv - Microbiology 2020Quote: ... and the control VSV-G protein pseudotyped Lentivirus (HLUC-Lv201 Firefly luciferase − eGFP lentifect-GeneCopoeia) at a concentration of 4,9E−9 GC/mL and 1,2E−9 GC/mL ...
-
bioRxiv - Biophysics 2020Quote: Plasmids encoding C-terminal eGFP-labeled full-length human LIM proteins were purchased from GeneCopoeia in the m98 vector ...
-
bioRxiv - Bioengineering 2019Quote: ... was PCR-amplified and fused to the extracellular domain of mouse FcγRI (GeneCopoeia, Rockville, MD) via overlap PCR amplification ...
-
bioRxiv - Neuroscience 2020Quote: ... The plasmids used were mouse full length GSAP with HA tag (EX-Mm30424-M07, Genecopoeia), human GSAP-16k with HA tag (a.a ...
-
bioRxiv - Immunology 2021Quote: The lentiviral shRNA vector set targeting mouse Vcan (NM_019389.2) and scrambled control were purchased from GeneCopoeia (#MSH080253-LVRU6H and #CSHCTR001-LVRU6H) ...
-
bioRxiv - Developmental Biology 2022Quote: ... HUVECs were transfected with 1μg of pcDNA3 plasmid vector containing a full-length mouse Vegfr3 cDNA (GeneCopoeia), or with empty vector (Martucciello et al. ...
-
bioRxiv - Neuroscience 2022Quote: The cDNAs of mouse PS Synthase I (PtdSSI, PSSI) and II (PtdSSII, PSSII) were obtained from GeneCopoeia, Inc ...
-
bioRxiv - Physiology 2020Quote: ... The mouse variant of IRAG in pReceiver-M61 was purchased from GeneCopoeia (Rockville, MD; Cat. #EX-Mm30453-M61). All HCN4 experiments were performed in stable cell lines ...
-
bioRxiv - Cell Biology 2019Quote: ... containing an sgRNA targeting TCGACAGCCTTATGGCGGAC in the mouse PFN1 gene and the puromycin donor plasmid pDonor-D01 (Genecopoeia) for selection ...
-
bioRxiv - Cancer Biology 2019Quote: The bacterial expression vectors pReceiver-B11 for His-NSMCE2 and His-PFDN2 recombinant protein expression were purchased from Genecopoeia, Inc (Rockville ...
-
bioRxiv - Biochemistry 2023Quote: Lenti-SARS-CoV-2 Full Length Spike protein-pseudotyped (WT) and ACE2+ 293 cell lines were purchased from Genecopoeia. Viruses were produced as recommended by the manufacturer and harbored a luciferase expressing plasmid ...
-
bioRxiv - Neuroscience 2020Quote: ... REST overexpression was performed by transducing DRG neurons with lentiviral constructs containing either REST (Lv135-REST) or humanized luciferase protein (Lv135-hLuc) as a control driven by the CMV promoter (GeneCopoeia). DRG neurons were replated 7 days after the viral infection ...
-
bioRxiv - Cell Biology 2021Quote: ... WT and SIRT1 KO E14 mESCs were generated by CRISPR/Cas9 mediated gene editing technology using lentivirus carrying either all-in-one empty vector pCRISPR-CG01 vector or pCRISPR-CG01 containing different sgRNAs targeting mouse Sirt1 gene (GeneCopoeia). Stable single colonies were picked up and screened with immunoblotting assay using anti-SIRT1 antibodies ...
-
bioRxiv - Genomics 2020Quote: ... ESCs were co-transfected with a plasmid expressing the Cas9 proteins and the sgRNA guide sequence targeting the Rosa26 locus (Genome CRISPR™ mouse ROSA26 safe harbor gene knock-in kit, SH054, GeneCopoeia) and the HDR repair template plasmid containing either H2B-Dam or H2B-Dam-NoLS constructs flanked by the homology arms with a molar ratio of 1:3.
-
bioRxiv - Developmental Biology 2022Quote: ESCs were co-transfected with a plasmid expressing Cas9 protein and the sgRNA guide sequence targeting the Rosa26 locus (Genome CRISPR™ mouse ROSA26 safe harbor gene knock-in kit, SH054, GeneCopoeia) and the HDR repair template plasmid containing HA-FLAG-Pramel7WT and - PRAMEL7ΔN sequences under the CAG promoter ...
-
bioRxiv - Cancer Biology 2023Quote: ... with 10 μg of the following anti-FOXM1 shRNA from Genecopoeia: sh-C (5’-TAATACGACTCACTATAGGG-3’ ...