Labshake search
Citations for GeneCopoeia :
1 - 10 of 10 citations for Monocyclohexyl Phthalate Unlabeled 100 Ug Ml In Mtbe since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... Control and miR-100 doxycycline inducible overexpression vectors (GeneCopoeia, MD) were created and then integrated into the genomes of tumor cells with lentiviruses ...
-
bioRxiv - Biochemistry 2023Quote: ... and DHR123 (2.8 µg/mL) (GeneCopoeia) diluted in serum-free culture medium at 37°C in the dark ...
-
bioRxiv - Cell Biology 2021Quote: ... Control scrambled miRNA (“Scr”; Cat# AA08-CmiR0001-MR14-100, GeneCopoeia Inc, MD, USA) and miR-181c (“miR-181c OE” ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were incubated with 1 mL of MitoBeacon Red (GeneCopoeia, U.S.A.) for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... or with LV encoding for synapsin 1 (Syn1) fused to GFP (GeneCopoeia, Inc., cat.# LPP-Z5062-Lv103-100), for live-cell imaging ...
-
bioRxiv - Biochemistry 2020Quote: MIN6 cells were grown to ∼50% confluency in 100 mm dishes and then batch transfected with 1 µg of wild type pre-miR-200c (MmiR-3304-MR04, Genecopoeia) or mutant pre-miR-200c (Synthesized by Genscript ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were incubated in 2 μg/mL 4′,6-diamidino-2-phenylindole (DAPI, GeneCopoeia, C002) in PBS for 5 min at RT ...
-
bioRxiv - Cell Biology 2022Quote: Lentiviral shRNA against HCAR1 targeting 3’UTR regions of the gene (shHCAR1a: GCTTTATTTCAGGCCGAATGA; shHCAR1b: GCTCTGACCTTCTTCAAATCT) and the scrambled shRNA were purchased from GeneCopoeia (Cat# LPP-HSH007585-LVRU6MP-100). Targeting the 3’UTR regions allowed us to use our previous plasmid constructs for rescue experiments.
-
bioRxiv - Cancer Biology 2020Quote: ... cells were infected with lentivirus particles (MOI=20) in presence of 8 μg/ml polybrene (GeneCopoeia, Guangzhou, China) for 24 hr ...
-
bioRxiv - Neuroscience 2022Quote: 1,5μl of a viral mix (1:1) of AAV9:CMV-miR-124-mCherry (titer: ≥5×1012 GC/ml, GeneCopoeia) and AAV5:GFAP-Cre (titer:≥7×10¹² GC/ml ...