Labshake search
Citations for GeneCopoeia :
1 - 20 of 20 citations for IL 2 Rat HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: The bacterial expression vectors pReceiver-B11 for His-NSMCE2 and His-PFDN2 recombinant protein expression were purchased from Genecopoeia, Inc (Rockville ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primers for IL-8 and IL-1α were purchased from GeneCopoeia (Rockville, MD). VEGFA was amplified (95°C-15 sec ...
-
bioRxiv - Cancer Biology 2019Quote: ... Flag-PFDN2 and Flag-VIM) and the bacterial expression vectors pReceiver-B11 (His-NSMCE2 and His-PFDN2) were purchased from Genecopoeia, Inc ...
-
bioRxiv - Microbiology 2023Quote: His-tagged SSRP1 was PCR amplified from SSRP1 pReceiver (GeneCopoeia) using primers encoding an N-terminal His tag and NdeI/NotI cut sites for cloning into pET22b ...
-
bioRxiv - Cancer Biology 2020Quote: ... lentivirus particles were made using HEK293 cells (ATCC) transfected with 2nd generation packaging/envelope plasmids (Dr. Yasuhiro Ikeda, Mayo Clinic) and shRNA clones (GeneCopoeia). U251 cells were obtained from American Type Cell Culture and maintained for in vitro experiments in DMEM supplemented with 10% FBS and 1% Antibiotic Antimycotic Solution ...
-
bioRxiv - Neuroscience 2019Quote: ... shRNA against rat Tpm3.1 (NM_173111.1) was purchased from GeneCopoeia (RSH053175-33-mH1 ...
-
bioRxiv - Cancer Biology 2021Quote: INA-6 IL-32 KO cells were lentiviral transduced using OmicsLink™ ORF lentiviral expression system from GeneCopoeia. Vector for knock in of IL-32β ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were incubated in 2 μg/mL 4′,6-diamidino-2-phenylindole (DAPI, GeneCopoeia, C002) in PBS for 5 min at RT ...
-
bioRxiv - Cancer Biology 2021Quote: ... Vector for knock in of IL-32β: (transcript variant 8) EX-M0733-Lv121 and control vector: EX-EGFP-Lv121 were purchased from GeneCopoeia. Lentiviral packaging and transduction of cells were performed as described above and transduced cells were subjected to negative selection using puromycin.
-
bioRxiv - Microbiology 2020Quote: ... The cells were then infected with SARS-CoV-2 Spike-Pseudotyped Lentivirus (Firefly Luciferase SARS-CoV-2 lentiviral particles-GeneCopoeia) and the control VSV-G protein pseudotyped Lentivirus (HLUC-Lv201 Firefly luciferase − eGFP lentifect-GeneCopoeia ...
-
bioRxiv - Microbiology 2023Quote: ... using All-in-oneTM 2× qPCR mix (GeneCopoeia) with specific VACV primers against the C11 gene ...
-
bioRxiv - Neuroscience 2021Quote: ... The shRNA target sequence that gave maximum knockdown efficiency of rat PRG-1 was 5′-GCAAGAACGAGAGTCGCAAGA-3′ and was obtained from GeneCopoeia (Rockville, MD, #RSH090356). Human PRG-1 obtained from DNASU Plasmid Repository (The Biodesign Institute/Arizona State University ...
-
bioRxiv - Microbiology 2023Quote: ... with an All-in-one 2×qPCR mix (GeneCopoeia) and primers specific for VACV genome ...
-
bioRxiv - Immunology 2022Quote: The SARS-CoV-2 pseudovirus assay was performed by Genecopoeia as previously described47 ...
-
bioRxiv - Cell Biology 2023Quote: ... a solution was prepared by adding 2 drops of EasyProbe-Hoechst 33342 Live Cell Stain (GeneCopoeia) into 1 ml of M9 buffer ...
-
bioRxiv - Cell Biology 2019Quote: HEK-293T cells were transfected with a transfer plasmid (pReceiver-Lv215) containing ZEB1 cDNA of transcript variant 2 (NM_030751.5) (GeneCopoeia) and a 3rd-generation packaging system ...
-
bioRxiv - Biochemistry 2023Quote: Lenti-SARS-CoV-2 Full Length Spike protein-pseudotyped (WT) and ACE2+ 293 cell lines were purchased from Genecopoeia. Viruses were produced as recommended by the manufacturer and harbored a luciferase expressing plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... Plasmids were introduced at 2 ng/μl of each (emerin shRNA, HSH095287-LVRU6MH; shRNA scramble sequence, CSHCTR001-LVRU6MH; Genecopoeia). For both methods ...
-
bioRxiv - Molecular Biology 2020Quote: ... we targeted exon 2 of NSUN6 with wild type Cas9 (pSpCAs9(BB)2A-GFP) plus the recombination vector pD07 (Genecopoeia) carrying the selection genes puromycin and eGFP under control of EIF1a promoter and with homology arms on Introns 1 and 2 ...
-
bioRxiv - Cell Biology 2022Quote: ... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...