Labshake search
Citations for GeneCopoeia :
1 - 22 of 22 citations for FLT3LG Mouse HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: The bacterial expression vectors pReceiver-B11 for His-NSMCE2 and His-PFDN2 recombinant protein expression were purchased from Genecopoeia, Inc (Rockville ...
-
bioRxiv - Cancer Biology 2019Quote: ... Flag-PFDN2 and Flag-VIM) and the bacterial expression vectors pReceiver-B11 (His-NSMCE2 and His-PFDN2) were purchased from Genecopoeia, Inc ...
-
bioRxiv - Microbiology 2023Quote: His-tagged SSRP1 was PCR amplified from SSRP1 pReceiver (GeneCopoeia) using primers encoding an N-terminal His tag and NdeI/NotI cut sites for cloning into pET22b ...
-
bioRxiv - Cancer Biology 2020Quote: ... lentivirus particles were made using HEK293 cells (ATCC) transfected with 2nd generation packaging/envelope plasmids (Dr. Yasuhiro Ikeda, Mayo Clinic) and shRNA clones (GeneCopoeia). U251 cells were obtained from American Type Cell Culture and maintained for in vitro experiments in DMEM supplemented with 10% FBS and 1% Antibiotic Antimycotic Solution ...
-
bioRxiv - Immunology 2021Quote: ... containing mouse CD4-eYFP (GeneCopoeia), into a pcDNA3.1 tGFP-P2A-mCherry vector ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primers for mouse Sprr1a (GeneCopoeia, MQP028278) and human Sprr1a (GeneCopoeia ...
-
bioRxiv - Neuroscience 2020Quote: ... To upregulate NMDAR expression in a cell-type-specific manner, mouse GluN1 cDNA (OMu21895D, Genescript) and mouse GluN2B cDNA (EX-Mm24581-M02, Genecopoeia) were cloned to custom-made vectors ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmid pCMV-SPORT6-Rab11a (mouse) was purchased from GeneCopoeia Inc ...
-
bioRxiv - Systems Biology 2021Quote: ... and pShuttle Gateway PLUS ORF Clone for mouse CCN4 (GC-Mm21303, GeneCopoeia). Lentiviruses were packaged as described (33 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pShuttle Gateway PLUS ORF Clone for mouse CCN4 (GC-Mm21303, GeneCopoeia). Lentiviruses were packaged as described (11 ...
-
bioRxiv - Neuroscience 2021Quote: ... a commercial plasmid encoding full-length mouse LAG3 CDS (GeneCopoeia, Mm0357-02) was used as standard ...
-
bioRxiv - Neuroscience 2021Quote: ... human or mouse LAG3 cDNA sequence (GeneCopoeia #EX-Z5714-M02 and #EX-Mm03576-M02) were inserted into an autoregulatory ...
-
bioRxiv - Bioengineering 2019Quote: ... was PCR-amplified and fused to the extracellular domain of mouse FcγRI (GeneCopoeia, Rockville, MD) via overlap PCR amplification ...
-
bioRxiv - Neuroscience 2020Quote: ... The plasmids used were mouse full length GSAP with HA tag (EX-Mm30424-M07, Genecopoeia), human GSAP-16k with HA tag (a.a ...
-
bioRxiv - Immunology 2021Quote: The lentiviral shRNA vector set targeting mouse Vcan (NM_019389.2) and scrambled control were purchased from GeneCopoeia (#MSH080253-LVRU6H and #CSHCTR001-LVRU6H) ...
-
bioRxiv - Developmental Biology 2022Quote: ... HUVECs were transfected with 1μg of pcDNA3 plasmid vector containing a full-length mouse Vegfr3 cDNA (GeneCopoeia), or with empty vector (Martucciello et al. ...
-
bioRxiv - Neuroscience 2022Quote: The cDNAs of mouse PS Synthase I (PtdSSI, PSSI) and II (PtdSSII, PSSII) were obtained from GeneCopoeia, Inc ...
-
bioRxiv - Physiology 2020Quote: ... The mouse variant of IRAG in pReceiver-M61 was purchased from GeneCopoeia (Rockville, MD; Cat. #EX-Mm30453-M61). All HCN4 experiments were performed in stable cell lines ...
-
bioRxiv - Cell Biology 2019Quote: ... containing an sgRNA targeting TCGACAGCCTTATGGCGGAC in the mouse PFN1 gene and the puromycin donor plasmid pDonor-D01 (Genecopoeia) for selection ...
-
bioRxiv - Cell Biology 2021Quote: ... WT and SIRT1 KO E14 mESCs were generated by CRISPR/Cas9 mediated gene editing technology using lentivirus carrying either all-in-one empty vector pCRISPR-CG01 vector or pCRISPR-CG01 containing different sgRNAs targeting mouse Sirt1 gene (GeneCopoeia). Stable single colonies were picked up and screened with immunoblotting assay using anti-SIRT1 antibodies ...
-
bioRxiv - Genomics 2020Quote: ... ESCs were co-transfected with a plasmid expressing the Cas9 proteins and the sgRNA guide sequence targeting the Rosa26 locus (Genome CRISPR™ mouse ROSA26 safe harbor gene knock-in kit, SH054, GeneCopoeia) and the HDR repair template plasmid containing either H2B-Dam or H2B-Dam-NoLS constructs flanked by the homology arms with a molar ratio of 1:3.
-
bioRxiv - Developmental Biology 2022Quote: ESCs were co-transfected with a plasmid expressing Cas9 protein and the sgRNA guide sequence targeting the Rosa26 locus (Genome CRISPR™ mouse ROSA26 safe harbor gene knock-in kit, SH054, GeneCopoeia) and the HDR repair template plasmid containing HA-FLAG-Pramel7WT and - PRAMEL7ΔN sequences under the CAG promoter ...