Labshake search
Citations for GeneCopoeia :
1 - 48 of 48 citations for 7 Bromo 2 chloromethyl 4H pyrido 1 2 a pyrimidin 4 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... with an All-in-one 2×qPCR mix (GeneCopoeia) and primers specific for VACV genome ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were incubated in 2 μg/mL 4′,6-diamidino-2-phenylindole (DAPI, GeneCopoeia, C002) in PBS for 5 min at RT ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were then infected with SARS-CoV-2 Spike-Pseudotyped Lentivirus (Firefly Luciferase SARS-CoV-2 lentiviral particles-GeneCopoeia) and the control VSV-G protein pseudotyped Lentivirus (HLUC-Lv201 Firefly luciferase − eGFP lentifect-GeneCopoeia ...
-
bioRxiv - Cell Biology 2022Quote: ... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
bioRxiv - Microbiology 2023Quote: ... using All-in-oneTM 2× qPCR mix (GeneCopoeia) with specific VACV primers against the C11 gene ...
-
bioRxiv - Immunology 2022Quote: The SARS-CoV-2 pseudovirus assay was performed by Genecopoeia as previously described47 ...
-
bioRxiv - Neuroscience 2020Quote: ... using All-in-One qPCR Mix (GeneCopoeia). Quantitative PCR consisted of 40 cycles ...
-
bioRxiv - Genetics 2021Quote: ... reverse transcription and real time RT-qPCR analysis were carried out using the ALL-in-ONE First-Strand cDNA Synthesis Kit and All-in-One qPCR Mix (GeneCopoeia) and the SsoFast EvaGreen Supermix according to the manufacturer’s protocols on CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... One plasmid on the pCRISPR-CG01 backbone (GeneCopoeia) codes for recombinant Cas9 and a sgRNA (5’-GCCAAACATAAGTGACCAAC-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... a solution was prepared by adding 2 drops of EasyProbe-Hoechst 33342 Live Cell Stain (GeneCopoeia) into 1 ml of M9 buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNAs were subjected to real-time qPCR in a Step-One Plus system (Applied Biosystem) using The All-in-One qPCR Mix (GeneCopoeia, #QP001-01). Sequences of oligonucleotides used are ...
-
bioRxiv - Neuroscience 2020Quote: ... The All-in-One qPCR Mix (GeneCopoeia, #QP001-01) was used to perform RT-qPCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... and furin (DNA ratio 4:1) using polyethylenimine (PEI) or EndoFectinTM Max (GeneCopoeia). One-week post-transfection ...
-
bioRxiv - Cell Biology 2019Quote: HEK-293T cells were transfected with a transfer plasmid (pReceiver-Lv215) containing ZEB1 cDNA of transcript variant 2 (NM_030751.5) (GeneCopoeia) and a 3rd-generation packaging system ...
-
bioRxiv - Cell Biology 2021Quote: HeLa cells were transfected with an all-in-one CRISPR/Cas9 plasmid for CLN5 (plasmid number HCP202087-CG01-1-B, Genecopoeia, Rockville, MD). 72 hours post-transfection ...
-
bioRxiv - Biochemistry 2023Quote: Lenti-SARS-CoV-2 Full Length Spike protein-pseudotyped (WT) and ACE2+ 293 cell lines were purchased from Genecopoeia. Viruses were produced as recommended by the manufacturer and harbored a luciferase expressing plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... Plasmids were introduced at 2 ng/μl of each (emerin shRNA, HSH095287-LVRU6MH; shRNA scramble sequence, CSHCTR001-LVRU6MH; Genecopoeia). For both methods ...
-
bioRxiv - Molecular Biology 2020Quote: ... we targeted exon 2 of NSUN6 with wild type Cas9 (pSpCAs9(BB)2A-GFP) plus the recombination vector pD07 (Genecopoeia) carrying the selection genes puromycin and eGFP under control of EIF1a promoter and with homology arms on Introns 1 and 2 ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR was performed using All-in-one qPCR Mix (GeneCopoeia, QP005) with primers specific for E3L ...
-
bioRxiv - Microbiology 2021Quote: An All-in-One miRNA qRT-PCR Detection Kit (GeneCopoeia, Rockville, MD) was used for milRNA expression analysis [12] ...
-
bioRxiv - Neuroscience 2021Quote: ... qPCR was performed with 2X All-in-One qPCR Mix (Genecopoeia Catalog#: QP001) using the following reaction mix ...
-
bioRxiv - Cancer Biology 2020Quote: All-in-one CRISPR-Cas9 clones targeting Snord67 were purchased from Genecopoeia (vector pCRISPR-CG02). sgRNA sequences were designed with help from CRISPOR (51 ...
-
bioRxiv - Physiology 2023Quote: Huh-7 or AML12 cells (2.5 x 105) were reverse transfected in triplicate in 6 well plates using Endofectin (Genecopoeia) with the indicated doses of miRIDIAN miRNA mimics (miR-541-3p) ...
-
bioRxiv - Cancer Biology 2020Quote: ... all-in-one CRISPR plasmids with mCherry reporter were purchased from Genecopoeia (Cat # HCP218175-CG01, HCP216131-CG01).Cells were transfected with CRISPR plasmids ...
-
bioRxiv - Neuroscience 2023Quote: ... All-in-one predesigned CRISPR constructs with both gRNA and Cas9 expression cassettes were purchased from Genecopoeia. The negative control (NC ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA levels were quantified using the Blaze Taq one-step SYBR Green RT-qPCR kit (GeneCopoeia, QP070) according to the manufacturer’s protocol and acquired on the ROCHE Lightcycler-96 system ...
-
bioRxiv - Genomics 2020Quote: ... The cDNA was also subjected to qPCR with All-in-One qPCR Mix (QP001; GeneCopoeia, Rockville, MD, USA) using the Mx3005P qPCR system (Agilent Technologies ...
-
bioRxiv - Cell Biology 2019Quote: ... The A549 and UMUC3 TRAP1 KO clones were made using the all in one vector harboring a mCherry reporter (Genecopoeia, HCP200164-CG08-3 ...
-
bioRxiv - Cell Biology 2019Quote: ... HeLa cells were transfected with an all-in-one CRISPR/Cas9 plasmid for Rab7A (plasmid number HTN218819, Genecopoeia, Rockville, MD). 72 hrs post-transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... WT and SIRT1 KO E14 mESCs were generated by CRISPR/Cas9 mediated gene editing technology using lentivirus carrying either all-in-one empty vector pCRISPR-CG01 vector or pCRISPR-CG01 containing different sgRNAs targeting mouse Sirt1 gene (GeneCopoeia). Stable single colonies were picked up and screened with immunoblotting assay using anti-SIRT1 antibodies ...
-
bioRxiv - Zoology 2021Quote: RNA was extracted and reverse-transcribed to cDNA using HiScript II Q RT SuperMix for qPCR(Vazyme, China) or All-in-One™ miRNA First-Strand cDNA Synthesis Kit (Genecopoeia,US). sigA gene or MysA was used as an internal reference ...
-
bioRxiv - Neuroscience 2022Quote: 1,5μl of a viral mix (1:1) of AAV9:CMV-miR-124-mCherry (titer: ≥5×1012 GC/ml, GeneCopoeia) and AAV5:GFAP-Cre (titer:≥7×10¹² GC/ml ...
-
bioRxiv - Bioengineering 2022Quote: ... and PRG4-gLuc (9,394 Bp, Genecopoeia, Fig. 1) were purified from transformed competent E ...
-
bioRxiv - Cell Biology 2021Quote: ... pCRISPR-CG01 (HCP216100-CG01-1-10) was purchased from GeneCopoeia and pcDNA3-Flag-mTOR wt (ID-26603 ...
-
bioRxiv - Cancer Biology 2021Quote: ... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were incubated with 1 mL of MitoBeacon Red (GeneCopoeia, U.S.A.) for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... Syncytin-1 cDNA tagged with a V5 epitope sequence (#T0264; GeneCopoeia) was cloned into phCMV-EcoENV (Addgene #15802 ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 μg of plasmids and 5 μL of EndoFectin (GeneCopoeia, EF014) were mixed with 125 μL of Opti-MEM reduced serum media (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... The secondary fluorescent antibodies was Goat anti rabbit (1:1000, L114A, GeneCopoeia, United States). Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole ...
-
bioRxiv - Cancer Biology 2022Quote: ... The JeKo-1 cell line expressing luciferase was generated using HLUC-Lv105 lentiviral particles (GeneCopoeia) and selected with puromycin ...
-
bioRxiv - Microbiology 2022Quote: ... Beta) and Brazil B.1.1.28.1/P.1 (EX-CoV245-M39-GS, Gamma) vectors were obtained from GeneCopoeia. The mutants N501Y ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were infected with 1 × 106 TERT Human Lentifect Purified Lentiviral Particles (GeneCopoeia, LPP-Q0450-Lv05-200-S). To aid in infection ...
-
bioRxiv - Neuroscience 2020Quote: ... or with LV encoding for synapsin 1 (Syn1) fused to GFP (GeneCopoeia, Inc., cat.# LPP-Z5062-Lv103-100), for live-cell imaging ...
-
bioRxiv - Microbiology 2021Quote: ... 1): AGM Vero E6 cells were transduced with the newly generated Vervet sgRNA library and human HEK293T-hACE2 cells (Genecopoeia) were transduced with the Brunello sgRNA library ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lentiviral particles for MART-1 expressed from an EF1a promoter with an IRES-eGFP were purchased from Genecopoeia (G0616-Lv225). GFP control was expressed using a lentiviral vector with an EF1a promoter and IRES-eGFP.
-
bioRxiv - Biochemistry 2020Quote: MIN6 cells were grown to ∼50% confluency in 100 mm dishes and then batch transfected with 1 µg of wild type pre-miR-200c (MmiR-3304-MR04, Genecopoeia) or mutant pre-miR-200c (Synthesized by Genscript ...
-
bioRxiv - Biochemistry 2022Quote: ... pGEX-GST-6P-1-GST-PHC3 was generated similarly with PCR amplification of PHC3 using pEZ-M39-PHC3-FLAG (EX-L3818-M39, Genecopoeia) and ligation into pGEX-GST-PHC2-Cerulean FLAG after digestion to remove PHC2 ...
-
bioRxiv - Neuroscience 2021Quote: ... The shRNA target sequence that gave maximum knockdown efficiency of rat PRG-1 was 5′-GCAAGAACGAGAGTCGCAAGA-3′ and was obtained from GeneCopoeia (Rockville, MD, #RSH090356). Human PRG-1 obtained from DNASU Plasmid Repository (The Biodesign Institute/Arizona State University ...