Labshake search
Citations for GeneCopoeia :
1 - 33 of 33 citations for 5 OXO 5 6 7 8 TETRAHYDRO NAPHTHALENE 1 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... 1 μg of plasmids and 5 μL of EndoFectin (GeneCopoeia, EF014) were mixed with 125 μL of Opti-MEM reduced serum media (Gibco ...
-
bioRxiv - Neuroscience 2022Quote: 1,5μl of a viral mix (1:1) of AAV9:CMV-miR-124-mCherry (titer: ≥5×1012 GC/ml, GeneCopoeia) and AAV5:GFAP-Cre (titer:≥7×10¹² GC/ml ...
-
bioRxiv - Physiology 2023Quote: Huh-7 or AML12 cells (2.5 x 105) were reverse transfected in triplicate in 6 well plates using Endofectin (Genecopoeia) with the indicated doses of miRIDIAN miRNA mimics (miR-541-3p) ...
-
bioRxiv - Neuroscience 2021Quote: ... The shRNA target sequence that gave maximum knockdown efficiency of rat PRG-1 was 5′-GCAAGAACGAGAGTCGCAAGA-3′ and was obtained from GeneCopoeia (Rockville, MD, #RSH090356). Human PRG-1 obtained from DNASU Plasmid Repository (The Biodesign Institute/Arizona State University ...
-
bioRxiv - Cancer Biology 2022Quote: ... Suit2 cells were transduced with ST6GAL1-expressing lentivirus (Genecopoeia, cat#LPP-M0351-Lv105-200-5) or empty vector lentivirus (Sigma) ...
-
bioRxiv - Cancer Biology 2023Quote: ... MT-5 cell line were also transduced to stably express luciferase using LentifectTM (GeneCopoeia #LPP-HLUC-Lv105-025-C) lentiviral vectors of firefly luciferase ...
-
bioRxiv - Immunology 2021Quote: ... the TCRα and TCRβ sequences were generated with Stitchr (using the same TRBC2 constant region and TRAV21/TRBV6-5 leader sequences for reliable expression) and cloned into a pReceiver-based lentiviral vector (GeneCopoeia) that contained an EF1α promoter and puromycin resistance gene ...
-
bioRxiv - Cancer Biology 2023Quote: ... sh-C (5’-TAATACGACTCACTATAGGG-3’; HSH096566-LVRU6GP-c); sh-E (5’-TAATACGACTCACTATAGGG-3’; HSH096566-LVRU6GP-e) or with the scrambled control (CSHCTR001-LVRU6GP, Genecopoeia), and the following packaging vectors ...
-
bioRxiv - Physiology 2019Quote: ... COS-7 cells were transfected with 5 μg of plasmid expressing human ApoB48 cDNA under the control of CMV promoter using endofectin (Genecopoeia, EF014) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... Two μg of the construct containing mS29 was transfected to the HEK293T mS29-KO cell line using 5 μL of EndoFectin™ Max (GeneCopoeia) pre-incubated in Opti-MEM (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primers for IL-8 and IL-1α were purchased from GeneCopoeia (Rockville, MD). VEGFA was amplified (95°C-15 sec ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were incubated in 2 μg/mL 4′,6-diamidino-2-phenylindole (DAPI, GeneCopoeia, C002) in PBS for 5 min at RT ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were infected with lentivirus particles (MOI=20) in presence of 8 μg/ml polybrene (GeneCopoeia, Guangzhou, China) for 24 hr ...
-
bioRxiv - Cancer Biology 2021Quote: ... Vector for knock in of IL-32β: (transcript variant 8) EX-M0733-Lv121 and control vector: EX-EGFP-Lv121 were purchased from GeneCopoeia. Lentiviral packaging and transduction of cells were performed as described above and transduced cells were subjected to negative selection using puromycin.
-
bioRxiv - Cancer Biology 2021Quote: INA-6 IL-32 KO cells were lentiviral transduced using OmicsLink™ ORF lentiviral expression system from GeneCopoeia. Vector for knock in of IL-32β ...
-
bioRxiv - Cancer Biology 2022Quote: ... Murine 266-6 cells (ATCC cat#CRL-2151) were transduced with lentivirus encoding St6gal1 (Genecopoeia, cat#LPP-EX-Mm05221-Lv105) or shRNA against St6gal1 (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
bioRxiv - Bioengineering 2022Quote: ... and PRG4-gLuc (9,394 Bp, Genecopoeia, Fig. 1) were purified from transformed competent E ...
-
bioRxiv - Cell Biology 2021Quote: ... pCRISPR-CG01 (HCP216100-CG01-1-10) was purchased from GeneCopoeia and pcDNA3-Flag-mTOR wt (ID-26603 ...
-
bioRxiv - Cancer Biology 2021Quote: ... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were incubated with 1 mL of MitoBeacon Red (GeneCopoeia, U.S.A.) for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... Syncytin-1 cDNA tagged with a V5 epitope sequence (#T0264; GeneCopoeia) was cloned into phCMV-EcoENV (Addgene #15802 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and furin (DNA ratio 4:1) using polyethylenimine (PEI) or EndoFectinTM Max (GeneCopoeia). One-week post-transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... The secondary fluorescent antibodies was Goat anti rabbit (1:1000, L114A, GeneCopoeia, United States). Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole ...
-
bioRxiv - Cancer Biology 2022Quote: ... The JeKo-1 cell line expressing luciferase was generated using HLUC-Lv105 lentiviral particles (GeneCopoeia) and selected with puromycin ...
-
bioRxiv - Microbiology 2022Quote: ... Beta) and Brazil B.1.1.28.1/P.1 (EX-CoV245-M39-GS, Gamma) vectors were obtained from GeneCopoeia. The mutants N501Y ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were infected with 1 × 106 TERT Human Lentifect Purified Lentiviral Particles (GeneCopoeia, LPP-Q0450-Lv05-200-S). To aid in infection ...
-
bioRxiv - Neuroscience 2020Quote: ... or with LV encoding for synapsin 1 (Syn1) fused to GFP (GeneCopoeia, Inc., cat.# LPP-Z5062-Lv103-100), for live-cell imaging ...
-
bioRxiv - Microbiology 2021Quote: ... 1): AGM Vero E6 cells were transduced with the newly generated Vervet sgRNA library and human HEK293T-hACE2 cells (Genecopoeia) were transduced with the Brunello sgRNA library ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lentiviral particles for MART-1 expressed from an EF1a promoter with an IRES-eGFP were purchased from Genecopoeia (G0616-Lv225). GFP control was expressed using a lentiviral vector with an EF1a promoter and IRES-eGFP.
-
bioRxiv - Biochemistry 2020Quote: MIN6 cells were grown to ∼50% confluency in 100 mm dishes and then batch transfected with 1 µg of wild type pre-miR-200c (MmiR-3304-MR04, Genecopoeia) or mutant pre-miR-200c (Synthesized by Genscript ...
-
bioRxiv - Biochemistry 2022Quote: ... pGEX-GST-6P-1-GST-PHC3 was generated similarly with PCR amplification of PHC3 using pEZ-M39-PHC3-FLAG (EX-L3818-M39, Genecopoeia) and ligation into pGEX-GST-PHC2-Cerulean FLAG after digestion to remove PHC2 ...
-
bioRxiv - Cell Biology 2021Quote: HeLa cells were transfected with an all-in-one CRISPR/Cas9 plasmid for CLN5 (plasmid number HCP202087-CG01-1-B, Genecopoeia, Rockville, MD). 72 hours post-transfection ...