Labshake search
Citations for Epoch Life Science :
1 - 40 of 40 citations for Mouse Alpha 1 antitrypsin 1 3 SERPINA1C ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... we produced a mouse Tacr1 DNA construct by gene synthesis (Epoch Life Science, GS66243-3). Tacr1 was subcloned along with a synthesized human G-protein α-subunit gene Gα15 and GCaMP6s it into the lentiviral plasmid backbone pLV-CMV-PGK-Hyg (Cellomics Technology ...
-
bioRxiv - Synthetic Biology 2022Quote: ... followed by 1% agarose gel electrophoresis and gel purification using a gel extraction kit (Epoch Life Science, 2260050). Recovered PCR products were digested with SpeI-HF and MluI-HF ...
-
bioRxiv - Synthetic Biology 2021Quote: ... at 37°C for 1 hour and agarose gel-purified with GenCatch Advanced Gel Extraction Kit (Epoch Life Science, Inc., No. 2260050). eGFP fluorescence was measured at λex 488 nm and λem 509 nm with plate reader PMT setting “medium” and 6 reads per well ...
-
bioRxiv - Bioengineering 2020Quote: ... 10 ng of the oligopool resuspended at 1 ng/μL in EB (Epoch Life Science), diluted to 50 μL total volume with dH2O ...
-
bioRxiv - Bioengineering 2021Quote: ... Plasmid DNA was extracted from 1 mL of suspended culture via miniprep (Epoch Life Science). The transformation yielded approximately 21 million colonies ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Level 3 166k-member assemblies were purified using a miniprep column (Epoch Life Sciences), electroporated (BioRad ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 1999) and 1 GRE (5’AGAACAGT3’ > 5’TAGCATCT3’) were generated by site-directed mutagenesis (Epoch Life Sciences). Transactivation Assays ...
-
bioRxiv - Molecular Biology 2024Quote: ... The PCR product was purified using EconoSpin TM All-in-1 Mini Spin Columns (Epoch Life Science, 1920-250) and eluted with RNase free water ...
-
bioRxiv - Neuroscience 2019Quote: ... and EGFP genes into the pAAV-CAG vector to obtain the final constructs described in Supplementary Table 1 (gene synthesis and subcloning were performed by Epoch Life Science Inc.). For in vivo expression in the mouse brain via in utero electroporation (IUE) ...
-
bioRxiv - Biochemistry 2024Quote: ... The template for PCR was digested with DpnI then purified using EconoSpin TM All-in-1 Mini Spin Columns (Epoch Life Science, 1920-250) and eluted in RNase free water ...
-
bioRxiv - Microbiology 2024Quote: The full-length mouse BICD2 sequence (UniProt Q921C5) was codon optimized for expression in Sf9 insect cells (Epoch Life Sciences) and cloned into a pACEBac1 vector encoding a N-terminal Strep-tag followed a PreScission (Psc ...
-
bioRxiv - Genetics 2020Quote: ... and cleaned using GenCatch gel extraction kit (Epoch Life Science) according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2022Quote: ... Bacmids were isolated using a DNA midiprep kit (Epoch Life Science). 40 mL of a Sf9 suspension culture were prepared in ESF921 medium (Expression Systems ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Plasmid DNA was extracted using a mini plasmid preparation kit (Epoch Life Science). Analytical digests with MluI ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and then purified with GenCatch PCR Purification Kit (Epoch Life Science, Inc., No. 2360250). pKDsgRNA-trml was transformed into NEB® 5-alpha Competent E ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and plasmid DNA was isolated using a mini-prep kit (Epoch Life Science, 2160250). The DNA sequence was analyzed using a primer that binds upstream of the T7Max promoter and confirmed the transition into ORF.
-
bioRxiv - Microbiology 2023Quote: ... and RNA was extracted with GenCatch™ Total RNA Miniprep Kit (Epoch Life Sciences) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... DNA was extracted using the GenCatchPCR Purification kit (Epoch Life Science, Misouri City, TX) according to manufacturer instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... and the PCR products were gel-purified using GenCatchTM Gel Extraction Kit (Epoch Life Sciences). Primers used for gene-cloning and genotyping are detailed in Table S1 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The amplified oligo pool was then purified using GenCatchTM PCR Cleanup Kit (Epoch Life Science) and eluted in Tris buffer (pH = 8).
-
bioRxiv - Genetics 2022Quote: ... DNA was extracted using the GenCatch genomic DNA extraction kit (Epoch Life Science, Sugar Land, TX) following the manufacturer’s protocol for tissue samples ...
-
bioRxiv - Zoology 2023Quote: ... Microbial DNA was extracted using the GenCatch™ Plasmid DNA Mini-Prep Kit (Epoch Life Science) following manufacturer instructions with minor modifications ...
-
bioRxiv - Genomics 2024Quote: ... DNA fragments were gel purified using the GenCatch Gel Extraction Kit (cat# 2260250; Epoch Life Sciences), and split marker fragments fusing the LGIIK9het25 upstream to the PtrpC promoter (“UP” ...
-
bioRxiv - Microbiology 2021Quote: ... Total DNA was isolated using a GenCatch blood and tissue genomic mini-prep kit (Epoch Life Science). PCR for the detection of the full-length ORF50 gene was performed using primers ORF50_del_for 5’GCTTCCTCGTCTACAGAGGTCAGG and ORF50_del_rev 5’GGCACCCATACTAAGTTGTGATTC ...
-
bioRxiv - Cell Biology 2022Quote: ... and DNA was purified using GenCatch Advance Gel Extraction Kit (Epoch Life Sciences; Missouri City, TX, USA). Purified DNA was sequenced using Sanger sequencing (Genewiz ...
-
bioRxiv - Synthetic Biology 2021Quote: ... followed by agarose gel purification with GenCatch Advanced Gel Extraction Kit (Epoch Life Science, Inc., No. 2260050).
-
bioRxiv - Evolutionary Biology 2020Quote: ... or a GenCatch Blood and Tissue Genomic Mini-Prep Kit (Epoch Life Sciences, Sugar Land, TX, USA). DNA was sent to Diversity Arrays Technology (Bruce ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was isolated with the GenCatch Plus Genomic DNA Miniprep Kit (Epoch Life Science, Missouri City, TX) or with the DNeasy Blood & Tissue Kit (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... Total DNA was isolated using a GenCatch blood and tissue genomic mini-prep kit (Epoch Life Science). A nested PCR for the detection of the FRT-scar present in RDV-50.stop MHV68 was performed using 200 ng of genomic DNA with GoTaq polymerase (Promega ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The digested backbone and gene inserts were isolated using a PCR clean-up kit (Epoch Life Science, 2360250). The backbone was treated with rSAP (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... DNA extraction was performed using the GenCatch Plus Genomic DNA Miniprep Kit (1660250, Epoch Life Science, Missouri City, TX) according to the manufacturer’s instructions and the DNA was amplified in a qPCR assay using the following primers ...
-
bioRxiv - Molecular Biology 2023Quote: DNA was extracted from each tagged colony using the GenCatch genomic DNA extraction kit (Epoch Life Science, Sugar Land, TX) following the manufacturer’s protocol for tissue samples ...
-
bioRxiv - Molecular Biology 2024Quote: ... Plasmid DNA was purified from cells using a Qiagen 96 Plus Miniprep Kit and Econospin Miniprep Filter plates (Epoch Life Science). Purified plasmids were prepared for sequencing using a Tn5 transposase and tagmentation approach and sequenced using an Illumina MiSeq ...
-
bioRxiv - Molecular Biology 2024Quote: ... Plasmid DNA was purified from cells using a Qiagen 96 Plus Miniprep Kit and Econospin Miniprep Filter plates (Epoch Life Science). Purified plasmids were prepared for sequencing using a Tn5 transposase and tagmentation approach and sequenced using an Illumina MiSeq ...
-
bioRxiv - Microbiology 2024Quote: ... followed by extraction of total RNA using the GenCatch Total RNA Mini Prep Kit (1660250, Epoch Life Science, Missouri City, TX). RT-qPCR was performed using the primers described in “Binding and internalization assays”.
-
bioRxiv - Plant Biology 2021Quote: DNA from forty pennycress accessions was extracted from approximately 500 mg of leaf tissue pooled from five plants using a plant genomic DNA kit (Epoch Life Science). DNA was then subjected to whole genome sequencing on an Illumina Novaseq sequencer (2 x 125 bp) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Plasmid DNA was purified from cells using a Qiagen 96 Plus Miniprep Kit and Econospin Miniprep Filter plates (Epoch Life Science, 2020-001). Purified plasmids were prepared for sequencing using a Tn5 transposase and tagmentation approach and sequenced using an Illumina MiSeq ...
-
bioRxiv - Molecular Biology 2024Quote: All plasmids were isolated using standard protocols and reagents from the GenCatch plasmid DNA mini-prep kit (Epoch Life Science, Missouri City, TX). Amplification of target sequences under 5 kb were produced using Q5 high fidelity polymerase (NEB # M0491S ...
-
bioRxiv - Microbiology 2019Quote: ... we repeated the PCR at a 20µl volume and purified the PCR product with either GenCatch PCR Cleanup or Gel Extraction Kits (Epoch Life Sciences, Missouri City, TX) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... we repeated the PCR at a 20µl volume and purified the PCR product with either GenCatch PCR Cleanup or Gel Extraction Kits (Epoch Life Sciences, Missouri City, TX) according to manufacturer’s instructions ...