Labshake search
Citations for Epoch Life Science :
1 - 37 of 37 citations for DNA Sequencer since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... DNA was extracted using the GenCatch genomic DNA extraction kit (Epoch Life Science, Sugar Land, TX) following the manufacturer’s protocol for tissue samples ...
-
bioRxiv - Zoology 2023Quote: ... Microbial DNA was extracted using the GenCatch™ Plasmid DNA Mini-Prep Kit (Epoch Life Science) following manufacturer instructions with minor modifications ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was isolated with the GenCatch Plus Genomic DNA Miniprep Kit (Epoch Life Science, Missouri City, TX) or with the DNeasy Blood & Tissue Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: DNA was extracted from each tagged colony using the GenCatch genomic DNA extraction kit (Epoch Life Science, Sugar Land, TX) following the manufacturer’s protocol for tissue samples ...
-
bioRxiv - Microbiology 2023Quote: ... EconoSpin spin columns for DNA (Epoch Life Science) were used to isolate Plasmid DNA and genomic DNA fragments ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and the plasmid DNA was purified (Epoch Life Science). All genetic part sequences and plasmids used in this work are in Table S1 and S11 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... library DNA was harvested via miniprep (Epoch Life Science) on all transformed and plated cells ...
-
bioRxiv - Synthetic Biology 2021Quote: Plasmid DNA was prepared using the Econospin columns (Epoch Life Science) according to manufacturer’s protocols ...
-
bioRxiv - Synthetic Biology 2019Quote: ... plasmid DNA was isolated using mini plasmid preparation (Epoch Life Science). Analytical digests with MluI/BspEI were performed and run on gel electrophoresis to assay if a correct product was made ...
-
bioRxiv - Biochemistry 2022Quote: ... Bacmids were isolated using a DNA midiprep kit (Epoch Life Science). 40 mL of a Sf9 suspension culture were prepared in ESF921 medium (Expression Systems ...
-
bioRxiv - Bioengineering 2024Quote: ... and a DNA-binding plate from Epoch Life Sciences (2020-001). All constructs were verified by whole-plasmid sequencing (Primordium Labs).
-
bioRxiv - Developmental Biology 2021Quote: ... The Donor DNA sequence was synthesized by Epoch Life Science (http://www.epochlifescience.com) and cloned into a PBSK plasmid backbone.
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmid DNA was miniprepped (Econospin 96-well filter plate, Epoch Life Science) and verified by Sanger sequencing ...
-
bioRxiv - Bioengineering 2021Quote: ... DNA from 400 μL of suspension was extracted via miniprep (Epoch Life Science). Three replicates were performed on three different days.
-
bioRxiv - Microbiology 2021Quote: ... The supernatant was transferred to mini spin DNA purification columns (Epoch Life Science). 500 uL PB and 750uL PE buffer (Qiagen ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Plasmid DNA was extracted using a mini plasmid preparation kit (Epoch Life Science). Analytical digests with MluI ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... All cloning and DNA synthesis steps were performed by Epoch Life Science (Texas, USA). The sequence of pMDP5_cureEC958 was deposited to GenBank under accession number MZ723317.
-
bioRxiv - Bioengineering 2021Quote: ... DNA was extracted from 600 μL of each suspension via miniprep (Epoch Life Science). Three replicates were performed on three different days.
-
bioRxiv - Synthetic Biology 2022Quote: ... and plasmid DNA was isolated using a mini-prep kit (Epoch Life Science, 2160250). The DNA sequence was analyzed using a primer that binds upstream of the T7Max promoter and confirmed the transition into ORF.
-
bioRxiv - Immunology 2023Quote: ... DNA was extracted using the GenCatchPCR Purification kit (Epoch Life Science, Misouri City, TX) according to manufacturer instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... Plasmid DNA was extracted from 1 mL of suspended culture via miniprep (Epoch Life Science). The transformation yielded approximately 21 million colonies ...
-
bioRxiv - Neuroscience 2023Quote: ... we produced a mouse Tacr1 DNA construct by gene synthesis (Epoch Life Science, GS66243-3). Tacr1 was subcloned along with a synthesized human G-protein α-subunit gene Gα15 and GCaMP6s it into the lentiviral plasmid backbone pLV-CMV-PGK-Hyg (Cellomics Technology ...
-
bioRxiv - Microbiology 2019Quote: ... Recombinant transfer vector p72mCheryΔI177L was obtained by DNA synthesis (Epoch Life Sciences Missouri City, TX, USA).
-
bioRxiv - Microbiology 2021Quote: ... Total DNA was isolated using a GenCatch blood and tissue genomic mini-prep kit (Epoch Life Science). PCR for the detection of the full-length ORF50 gene was performed using primers ORF50_del_for 5’GCTTCCTCGTCTACAGAGGTCAGG and ORF50_del_rev 5’GGCACCCATACTAAGTTGTGATTC ...
-
bioRxiv - Cell Biology 2022Quote: ... and DNA was purified using GenCatch Advance Gel Extraction Kit (Epoch Life Sciences; Missouri City, TX, USA). Purified DNA was sequenced using Sanger sequencing (Genewiz ...
-
bioRxiv - Microbiology 2023Quote: ... Total DNA was isolated using a GenCatch blood and tissue genomic mini-prep kit (Epoch Life Science). A nested PCR for the detection of the FRT-scar present in RDV-50.stop MHV68 was performed using 200 ng of genomic DNA with GoTaq polymerase (Promega ...
-
bioRxiv - Genetics 2020Quote: ... 600 μL of clear lysate was transferred to DNA binding plates (Epoch Life Sciences EconoSpin™ 96 well) stacked over a 1 mL collection plate and centrifuged 5 minutes (RT ...
-
bioRxiv - Bioengineering 2022Quote: ... coli were transformed with 1.5 μL of purified plasmid DNA (Econospin 96-well filter plate, Epoch Life Science), and 1 mL of SOC medium (NEB ...
-
bioRxiv - Biochemistry 2022Quote: ... the DNA coding for LRRK1 was codon optimized for Spodoptera frugipera (Sf9) cells and synthesized by Epoch Life Science. The DNA was cloned via Gibson assembly into the pKL baculoviral expression vector ...
-
bioRxiv - Synthetic Biology 2021Quote: The DNAs encoding the protein motifs used in this study were mammalian-codon optimized and synthesized by Epoch Life Science and then cloned into mammalian expression backbones ...
-
bioRxiv - Molecular Biology 2024Quote: ... Plasmid DNA was purified from cells using a Qiagen 96 Plus Miniprep Kit and Econospin Miniprep Filter plates (Epoch Life Science). Purified plasmids were prepared for sequencing using a Tn5 transposase and tagmentation approach and sequenced using an Illumina MiSeq ...
-
bioRxiv - Molecular Biology 2024Quote: ... Plasmid DNA was purified from cells using a Qiagen 96 Plus Miniprep Kit and Econospin Miniprep Filter plates (Epoch Life Science). Purified plasmids were prepared for sequencing using a Tn5 transposase and tagmentation approach and sequenced using an Illumina MiSeq ...
-
bioRxiv - Bioengineering 2020Quote: ... The 300 bp resulting DNA was then gel extracted from a 2% agarose gel and purified via silicon spin column (Epoch Life Sciences) eluting with 30 μL dH2O per manufacturer’s instructions.
-
bioRxiv - Plant Biology 2021Quote: DNA from forty pennycress accessions was extracted from approximately 500 mg of leaf tissue pooled from five plants using a plant genomic DNA kit (Epoch Life Science). DNA was then subjected to whole genome sequencing on an Illumina Novaseq sequencer (2 x 125 bp) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... All plasmid preparation services (chemical synthesis of DNA insert sequences, sub-cloning into respective vector backbones, and the amplification) were obtained from Epoch Life Science, Inc ...
-
bioRxiv - Molecular Biology 2024Quote: ... Plasmid DNA was purified from cells using a Qiagen 96 Plus Miniprep Kit and Econospin Miniprep Filter plates (Epoch Life Science, 2020-001). Purified plasmids were prepared for sequencing using a Tn5 transposase and tagmentation approach and sequenced using an Illumina MiSeq ...
-
bioRxiv - Microbiology 2021Quote: ... 200 μL of isopropanol was added and mixed and the solution transferred to a DNA binding silica spin column (EconoSpin, Epoch Life Science, Missouri City, TX). After passing the solution through the column twice ...