Labshake search
Citations for Epoch Life Science :
1 - 42 of 42 citations for BCA Protein Colorimetric Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... coli codon-optimised genes encoding each full-length protein and isoform 2 of CPSF30 (Uniprot O95639-2) in pACEBac vectors were synthesized by Epoch Life Science. All cloning was validated by sequencing (Source Bioscience).
-
bioRxiv - Molecular Biology 2024Quote: ... Plasmid DNA was purified from cells using a Qiagen 96 Plus Miniprep Kit and Econospin Miniprep Filter plates (Epoch Life Science). Purified plasmids were prepared for sequencing using a Tn5 transposase and tagmentation approach and sequenced using an Illumina MiSeq ...
-
bioRxiv - Molecular Biology 2024Quote: ... Plasmid DNA was purified from cells using a Qiagen 96 Plus Miniprep Kit and Econospin Miniprep Filter plates (Epoch Life Science). Purified plasmids were prepared for sequencing using a Tn5 transposase and tagmentation approach and sequenced using an Illumina MiSeq ...
-
bioRxiv - Molecular Biology 2024Quote: ... Plasmid DNA was purified from cells using a Qiagen 96 Plus Miniprep Kit and Econospin Miniprep Filter plates (Epoch Life Science, 2020-001). Purified plasmids were prepared for sequencing using a Tn5 transposase and tagmentation approach and sequenced using an Illumina MiSeq ...
-
bioRxiv - Bioengineering 2024Quote: ... and a DNA-binding plate from Epoch Life Sciences (2020-001). All constructs were verified by whole-plasmid sequencing (Primordium Labs).
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmid DNA was miniprepped (Econospin 96-well filter plate, Epoch Life Science) and verified by Sanger sequencing ...
-
bioRxiv - Genetics 2021Quote: ... Transfer 480 μL of supernatant to a 96-well EconoSpin plate (Epoch Life Science, Texas, USA). Vacuum the EconoSpin plate on the vacuum manifold (MACHEREY-NAGEL ...
-
bioRxiv - Plant Biology 2023Quote: ... and RNA was extracted as described (Yaffe et al., 2012) using EconoSpin plate columns (Epoch Life Science). mRNA libraries were prepared following an in-house protocol (rCambiagno et al. ...
-
bioRxiv - Genetics 2020Quote: ... 600 μL of clear lysate was transferred to DNA binding plates (Epoch Life Sciences EconoSpin™ 96 well) stacked over a 1 mL collection plate and centrifuged 5 minutes (RT ...
-
bioRxiv - Bioengineering 2022Quote: ... coli were transformed with 1.5 μL of purified plasmid DNA (Econospin 96-well filter plate, Epoch Life Science), and 1 mL of SOC medium (NEB ...
-
bioRxiv - Immunology 2022Quote: ... and 143 mM 2-mercaptoethanol and purified on silica columns (Epoch Life Science). Using 500 ng of RNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... mixed with 600ul 70% ethanol and purified using 96-well column silica-membrane filter plates (Epoch Life sciences 2020-001) positioned over 2ml deep-well 96-well plates (VWR 40002-014 ...
-
bioRxiv - Genomics 2020Quote: ... rhinoceros using a DIY spin column protocol using 96-well silica filter plates from Epoch life sciences (Missouri City, TX, USA) (Ridley et al ...
-
bioRxiv - Biochemistry 2022Quote: The following Dynactin coding genes were codon-optimized for protein expression in insect cells and synthesized (Epoch Life Science): DCTN1 (Protein name p150 ...
-
bioRxiv - Synthetic Biology 2021Quote: The DNAs encoding the protein motifs used in this study were mammalian-codon optimized and synthesized by Epoch Life Science and then cloned into mammalian expression backbones ...
-
bioRxiv - Genetics 2020Quote: ... and cleaned using GenCatch gel extraction kit (Epoch Life Science) according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2022Quote: ... Bacmids were isolated using a DNA midiprep kit (Epoch Life Science). 40 mL of a Sf9 suspension culture were prepared in ESF921 medium (Expression Systems ...
-
bioRxiv - Bioengineering 2020Quote: ... The 300 bp resulting DNA was then gel extracted from a 2% agarose gel and purified via silicon spin column (Epoch Life Sciences) eluting with 30 μL dH2O per manufacturer’s instructions.
-
bioRxiv - Synthetic Biology 2023Quote: ... Plasmid DNA was extracted using a mini plasmid preparation kit (Epoch Life Science). Analytical digests with MluI ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and then purified with GenCatch PCR Purification Kit (Epoch Life Science, Inc., No. 2360250). pKDsgRNA-trml was transformed into NEB® 5-alpha Competent E ...
-
bioRxiv - Microbiology 2023Quote: ... and RNA was extracted with GenCatch™ Total RNA Miniprep Kit (Epoch Life Sciences) according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and plasmid DNA was isolated using a mini-prep kit (Epoch Life Science, 2160250). The DNA sequence was analyzed using a primer that binds upstream of the T7Max promoter and confirmed the transition into ORF.
-
bioRxiv - Immunology 2023Quote: ... DNA was extracted using the GenCatchPCR Purification kit (Epoch Life Science, Misouri City, TX) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2019Quote: ... Mammalian expression vectors were generated by inserting c-myc tag and mRuby3 red fluorescent protein upstream of full length NS1-2 and then subcloning this into the pTagRFP-N vector in place of TagRFP (Epoch Life Sciences, Missouri City, TX). This construct will be referred to as RFP-NS1-2 ...
-
bioRxiv - Plant Biology 2020Quote: ... and the PCR products were gel-purified using GenCatchTM Gel Extraction Kit (Epoch Life Sciences). Primers used for gene-cloning and genotyping are detailed in Table S1 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The amplified oligo pool was then purified using GenCatchTM PCR Cleanup Kit (Epoch Life Science) and eluted in Tris buffer (pH = 8).
-
bioRxiv - Microbiology 2022Quote: ... A 450 µl aliquot of the homogenate was then transferred to a sterile 2 ml EconoSpin mini spin column (catalog no. 1910-250, Epoch Life Science, Inc., Sugar Land, TX, USA) containing 450 µl of 70% (v/v ...
-
bioRxiv - Genetics 2022Quote: ... DNA was extracted using the GenCatch genomic DNA extraction kit (Epoch Life Science, Sugar Land, TX) following the manufacturer’s protocol for tissue samples ...
-
bioRxiv - Zoology 2023Quote: ... Microbial DNA was extracted using the GenCatch™ Plasmid DNA Mini-Prep Kit (Epoch Life Science) following manufacturer instructions with minor modifications ...
-
bioRxiv - Microbiology 2021Quote: ... Total DNA was isolated using a GenCatch blood and tissue genomic mini-prep kit (Epoch Life Science). PCR for the detection of the full-length ORF50 gene was performed using primers ORF50_del_for 5’GCTTCCTCGTCTACAGAGGTCAGG and ORF50_del_rev 5’GGCACCCATACTAAGTTGTGATTC ...
-
bioRxiv - Cell Biology 2022Quote: ... and DNA was purified using GenCatch Advance Gel Extraction Kit (Epoch Life Sciences; Missouri City, TX, USA). Purified DNA was sequenced using Sanger sequencing (Genewiz ...
-
bioRxiv - Synthetic Biology 2021Quote: ... followed by agarose gel purification with GenCatch Advanced Gel Extraction Kit (Epoch Life Science, Inc., No. 2260050).
-
bioRxiv - Evolutionary Biology 2020Quote: ... or a GenCatch Blood and Tissue Genomic Mini-Prep Kit (Epoch Life Sciences, Sugar Land, TX, USA). DNA was sent to Diversity Arrays Technology (Bruce ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was isolated with the GenCatch Plus Genomic DNA Miniprep Kit (Epoch Life Science, Missouri City, TX) or with the DNeasy Blood & Tissue Kit (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... Total DNA was isolated using a GenCatch blood and tissue genomic mini-prep kit (Epoch Life Science). A nested PCR for the detection of the FRT-scar present in RDV-50.stop MHV68 was performed using 200 ng of genomic DNA with GoTaq polymerase (Promega ...
-
bioRxiv - Synthetic Biology 2022Quote: ... followed by 1% agarose gel electrophoresis and gel purification using a gel extraction kit (Epoch Life Science, 2260050). Recovered PCR products were digested with SpeI-HF and MluI-HF ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The digested backbone and gene inserts were isolated using a PCR clean-up kit (Epoch Life Science, 2360250). The backbone was treated with rSAP (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: DNA was extracted from each tagged colony using the GenCatch genomic DNA extraction kit (Epoch Life Science, Sugar Land, TX) following the manufacturer’s protocol for tissue samples ...
-
bioRxiv - Plant Biology 2021Quote: DNA from forty pennycress accessions was extracted from approximately 500 mg of leaf tissue pooled from five plants using a plant genomic DNA kit (Epoch Life Science). DNA was then subjected to whole genome sequencing on an Illumina Novaseq sequencer (2 x 125 bp) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... at 37°C for 1 hour and agarose gel-purified with GenCatch Advanced Gel Extraction Kit (Epoch Life Science, Inc., No. 2260050). eGFP fluorescence was measured at λex 488 nm and λem 509 nm with plate reader PMT setting “medium” and 6 reads per well ...
-
bioRxiv - Microbiology 2019Quote: ... we repeated the PCR at a 20µl volume and purified the PCR product with either GenCatch PCR Cleanup or Gel Extraction Kits (Epoch Life Sciences, Missouri City, TX) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... we repeated the PCR at a 20µl volume and purified the PCR product with either GenCatch PCR Cleanup or Gel Extraction Kits (Epoch Life Sciences, Missouri City, TX) according to manufacturer’s instructions ...