Labshake search
Citations for Nzytech :
1 - 28 of 28 citations for rno mir 206 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... Reverse Transcriptase quantitative PCR (RT-qPCR) was performed using NZYSpeedy qPCR Green Master Mix ROX (#MB22302, NZYTech) or NZYSpeedy qPCR Green Master Mix ROX Plus (#MB22202 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Retro-transcription into cDNA was performed using a RT-PCR kit NZY First-Strand cDNA Synthesis Kit # MB12501 (NZYtech). Quantitative PCR (qPCR ...
-
bioRxiv - Cell Biology 2020Quote: ... Retro-transcription into cDNA was performed using a RT-PCR kit NZY First-Strand cDNA Synthesis Kit # MB12501 (NZYtech).
-
bioRxiv - Plant Biology 2019Quote: ... PCR amplification was carried out using primers listed in Supplementary Table 1 (relate to all figures) and Taq polymerase (NZYTech).
-
bioRxiv - Microbiology 2019Quote: ... The primer sequences were synthesized by NZYTech (Portugal) and the sequences are β-tubulin forward (ACGCTTGCGTCGGAACATAG) ...
-
bioRxiv - Developmental Biology 2022Quote: ... the coverslips were blocked for 1 h at RT with 2% BSA (NZYTech, MB04602), 2% FBS (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... Reverse transcription (RT) was performed using the NZY first strand cDNA synthesis kit (NZYTech, MB12502). Real-time RT-PCR was prepared in 384-well ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse transcription (RT) was performed using the NZY MuLV first strand cDNA synthesis kit (NZYTech, MB17302). Real-time RT-PCR to detect GAPDH ...
-
bioRxiv - Microbiology 2022Quote: ... The cDNA was then synthesized from 500 ng of RNA and used to evaluate gene expression by qPCR using the primers listed in Table S4 and the M-MuLV Reverse Transcriptase (NZYtech) in a QuantStudio3 machine using the PowerUp SYBR green qPCR master mix (Applied Biosystems) ...
-
bioRxiv - Microbiology 2024Quote: ... Correct insertion was checked by colony PCR using vector-specific primers (Forward: 5’-GAGAACCCACTGCTTACTGGC-3’; Reverse: 5’-AGGGTCAAGGAAGGCACG-3’) and the NZYTaq II 2x Green Master Mix (NZYtech). Plasmids with correct insertions were checked by Sanger (Eurofins ...
-
bioRxiv - Developmental Biology 2023Quote: ... (1) 2 hrs at RT or O/N at 4°C in 75 µg/ml of CBM3a-GFP (CZ00571, Nzytech), (2 ...
-
bioRxiv - Neuroscience 2024Quote: ... from 10 ng of RNA was performed using the One-step NZYTECH RT-qPCR Green kit according to manufactureŕs protocol (NZYTECH, MB34302). RT-PCR was normalized using the housekeeping genes hypoxanthine phosphoribosyl-transferase 1 (HPRT1 ...
-
bioRxiv - Microbiology 2021Quote: The PCR products were purified by using NZYGelpure kit (Nzytech) and sequenced upstream and downstream ...
-
bioRxiv - Plant Biology 2021Quote: ... PCR with the NZYTaq II 2x Green Master Mix (Nzytech) was performed on cDNA from three biological replicates of germinating seeds (18 hours after stratification ...
-
bioRxiv - Genetics 2020Quote: ... Edited founders were identified by PCR amplification (Taq polymerase, NZYtech) with primers flanking the edited region (see Table S8 for primer sequences) ...
-
bioRxiv - Bioengineering 2022Quote: ... Colony PCR with NZYTaq II 2x Green Master Mix (Nzytech) or DreamTaq 2x Green PCR Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR with the NZYTaq II 2x Green Master Mix (NZYtech) was performed on cDNA from 3-4 biological replicates of germinated seeds (44 h after stratification ...
-
Spatial and long-term temporal evolution of a marine mussel hybrid zone (Mytilus spp.) in SW EnglandbioRxiv - Evolutionary Biology 2023Quote: ... PCR products together with the NZYDNA ladder V (NZYtech, Lisbon, Portugal) were separated in 2% agarose gels supplemented with 2.5 µL of SYBR Safe dye at 90 volts for 40 minutes ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Colony PCR was performed using NZYTaq II 2x Green Master Mix solution (NZYTech, Portugal). DNA concentration was measured with NanoVue spectrophotometer (GE Healthcare ...
-
bioRxiv - Molecular Biology 2024Quote: ... Both PCR products (DNA or cDNA) were cleaned using the NZYGelpure kit (#MB01102, NzyTech) and sent for Sanger sequencing to STABVIDA with data visualized and analyzed using Chromas v2.6.2 software.
-
bioRxiv - Genomics 2023Quote: ... For 13 kb SCN10A PCR we used Supreme NZYLong DNA Polymerase (Cat. #MB331, NZYTech®) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... DNA fragments were amplified by PCR (Accuzyme DNA Polymerase, Bioline, or Supreme NZYProof DNA Polymerase, Nzytech) with specific oligonucleotides (listed in Table S4 ...
-
bioRxiv - Pathology 2023Quote: ... Quantitative PCR was performed in a 96-well optical plate using SYBR green master mix (NZYtech). PCR and data acquisition was performed using the AB7300 Real-Time PCR thermal cycler with Step One software (v2.2.2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR product was analysed by electrophoresis on a 2% agarose gel stained with Green Safe Premium (NZYTech).
-
bioRxiv - Cell Biology 2021Quote: ... DNA amplification was performed with 50 ng of genomic DNA from each individual by Polymerase Chain Reaction (PCR) using the NZYtaq II Green Master Mix (NZYtech). The primers used for each of the EDN-1 gene regions are described in Supp ...
-
bioRxiv - Immunology 2021Quote: ... Products derived from PCR were visualized on a 2% agarose/TBE gel with GreenSafe premium nucleic acid stain (NZYTech, Portugal). For primary diagnostics ...
-
bioRxiv - Cell Biology 2023Quote: ... For cloning the amplified fragments we used the NZY-A PCR cloning kit and NZYStar Competent Cells (refs. MB053 and MB00501 NZYTech, Portugal). Inserts contained in recombinant plasmids were sequenced as described above using plasmid based primers T7 (TAATACGACTCACTATAGGG ...
-
bioRxiv - Microbiology 2023Quote: ... The antibiotic resistance cassette together with genome flanking regions (∼600 bp) were amplified and PCR products were purified using the NZYGelpure kit (NZYTech, Lisbon, Portugal). These PCR fragments were transformed into B ...