Labshake search
Citations for Nzytech :
1 - 20 of 20 citations for Primary Human Brain Microvascular Endothelial Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: ... coli cells (NZYTech) grown in LB medium ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were lysed with NZYol (NZYtech) and RNA extracted using a standard protocol with chloroform-isopropanol-ethanol.
-
bioRxiv - Developmental Biology 2023Quote: RNA from FAC-Sorted EdU+ cells (neural cells >650,000) was isolated by NZY Total RNA Isolation kit (NZYTech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... coli BL21(DE3) Gold competent cells (Nzytech). 300 mL of Luria Bertani medium containing 50 μg/mL kanamycin was inoculated with a single colony of E ...
-
bioRxiv - Cell Biology 2021Quote: ... and used to transform NZYstar competent cells (NZYtech). The empty pGL3-Basic was used as a negative control and pRL-CMV (Promega ...
-
bioRxiv - Microbiology 2023Quote: ... and transformed into NZY5α competent cells (Nzytech MB00402). The presence of the mutation and the absence of undesired mutations were confirmed by Sanger sequencing.
-
bioRxiv - Biochemistry 2023Quote: ... DtGH67 and SthAraf62A expressing cells in autoinducible medium (NZYtech) supplemented with 50 µg.ml−1 kanamycin ...
-
bioRxiv - Microbiology 2024Quote: ... Assembled products were transformed into NY5α competent cells (NZYtech). Correct insertion was checked by colony PCR using vector-specific primers (Forward ...
-
bioRxiv - Cell Biology 2024Quote: ... total RNA from cells was extracted using either NZYol (NZYTech) or GRS Total RNA Kit (GRiSP) ...
-
bioRxiv - Molecular Biology 2020Quote: RNA extracts were obtained from cells using NZY Total RNA Isolation kit (Nzytech) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA was isolated from HeLa cells using NZYol reagent (NZYTech, Lisboa, Portugal). RNA concentration was determined using the DS-11 Series Spectrophotometer / Fluorometer (DeNovix ...
-
bioRxiv - Molecular Biology 2020Quote: Total RNA was extracted from cells using NZYOL™ RNA Isolation Reagent (NZYTech) and treated with DNase I (Roche ...
-
bioRxiv - Plant Biology 2021Quote: ... the cells were transferred to gelrite plates containing kanamycin (100mg/L) (NZYTech, Portugal) and ticarcillin disodium/clavulanate potassium (500mg/L ...
-
bioRxiv - Cell Biology 2023Quote: RNA extracts were obtained from cells using NZY Total RNA Isolation kit (Nzytech) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... The cells were then blocked with 1,5% bovine serum albumin (BSA, NZYTech, Lisbon, Portugal) for two hours ...
-
bioRxiv - Biochemistry 2023Quote: ... coli BL21 (DE3) cells harbouring these various plasmids were individually encapsulated in autoinducible medium (AIM, [NZYtech, Lisboa, Portugal]) supplemented with 50 µg.mL−1 kanamycin using the flow focussing device shown in Supplementary Figure S3C ...
-
bioRxiv - Microbiology 2023Quote: ... coli BL21-DE cells containing the respective plasmids were grown on NZY Auto-induction LB medium (NZYTech, Lisbon, Portugal) at 37°C for 20 h ...
-
bioRxiv - Microbiology 2023Quote: ... mk+) supE44 thi-1 recA1 gyrA96 relA1 lac[F′ proA+B+ lacIq ΔlacZM15:Tn10(TcR)]) chemically competent cells (NZYtech) were used as an intermediate host for cloning purposes and they were grow in LB medium at 37 °C under agitation ...
-
bioRxiv - Pathology 2023Quote: ... cDNA was obtained by retrotranscription of 500 ng of total RNA from mouse liver or HepG2 cells using NZY First-Strand cDNA synthesis kit (NZYTech). Pah ...
-
bioRxiv - Cell Biology 2023Quote: ... For cloning the amplified fragments we used the NZY-A PCR cloning kit and NZYStar Competent Cells (refs. MB053 and MB00501 NZYTech, Portugal). Inserts contained in recombinant plasmids were sequenced as described above using plasmid based primers T7 (TAATACGACTCACTATAGGG ...