Labshake search
Citations for The Jackson Laboratory :
1 - 50 of 50 citations for rno mir 194 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Genotypes were confirmed using primer sets recommended by Jackson Laboratory and Sinha lab.
-
bioRxiv - Neuroscience 2023Quote: ... Mice were genotyped with primer sets suggested by Jackson labs.
-
bioRxiv - Neuroscience 2021Quote: ... miR-17∼92fl/fl mice (miR-17∼92fl/fl, The Jackson Laboratory, JAX ...
-
bioRxiv - Immunology 2022Quote: ... Standard PCR reaction conditions and primer sequences from Jackson Laboratories were used for CD4cre ...
-
bioRxiv - Immunology 2021Quote: ... Standard PCR reaction conditions and primer sequences from Jackson Laboratories were used for Eomes ...
-
bioRxiv - Neuroscience 2023Quote: ... The recommended primers and PCR protocols designed by Jackson laboratories were used to verify the transgenes (primers purchased from Sigma) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primers and PCRs were done as specified by protocols by Jackson Laboratory. Identification of intact Tet2 (Protocol 19042 ...
-
bioRxiv - Microbiology 2021Quote: ... The heterozygous mice were crossed and genotyped to select heterozygous mice for experiments by using the primer sets recommended by Jackson Laboratory.
-
bioRxiv - Microbiology 2021Quote: ... The heterozygous mice were crossed and genotyped to select heterozygous mice for experiments by using the primer sets recommended by Jackson Laboratory.
-
bioRxiv - Physiology 2020Quote: ... floxed miR-150 mice (STOCK Mir150tm1Mtm/Mmjax mice from Jackson Laboratories) C57/Bl6 background were crossed with C57/Bl6 mice carrying tamoxifen-inducible Cre recombinase under the control of the Cdh5 promoter (Cdh5(PAC)-iCreERT2 (Wang ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tifab−/-;miR-146a−/- mice were crossed with Trp53−/- mice (Jackson Laboratories, 002101). All mice were bred ...
-
bioRxiv - Immunology 2021Quote: ... Sle1b mice [detailed previously (41)] were crossed to miR-21KO mice (Jackson Laboratory stock #016856) to generate Sle1b.miR-21KO ...
-
bioRxiv - Physiology 2023Quote: ... Genotyping was performed in-house by PCR from tail snip DNA samples using guidelines and primer sequences from Jackson Laboratory, or was performed by Transnetyx ...
-
bioRxiv - Neuroscience 2023Quote: ... Mice were genotyped to verify igfrf/f homozygosity and igfap-Cre/ERT or icamk2a-cre/ERT2 expression using the primers and suggested PCR protocols designed by Jackson laboratories, as previously reported (Prabhu ...
-
bioRxiv - Neuroscience 2023Quote: ... 21 mouse lines were used for experiments in this study and genotyping was performed using primers and polymerase chain reaction (PCR) conditions listed on the vendor website (Jackson labs). All animals were maintained on the C57BL6/L background ...
-
bioRxiv - Physiology 2019Quote: ... The DNA purified from the tails was used in PCR reactions for genotyping of mice in the SLAMF6 locus on chromosome 1 (primers adapted from the Jackson laboratories website) and in the Pmel-1 locus on chromosome 2 (Ji et al. ...
-
bioRxiv - Physiology 2022Quote: ... The deletion was confirmed using forward primer: TCAGGGAGTCAGTCATTAACCA and reverse primer: CAATAAGACCTGGCACAAGGA according to the protocol detailed by Jackson Laboratories (https://www.jax.org/Protocol?stockNumber=027197&protocolID=19636) ...
-
bioRxiv - Cell Biology 2021Quote: mgWAT from RT or cold exposed mice (Jackson Laboratory, #000664) was fixed in 10% formalin overnight ...
-
bioRxiv - Neuroscience 2021Quote: ... Genotyping was performed at weaning using primer sequences published by Jackson laboratories. Male and female mice were used in all experiments ...
-
bioRxiv - Immunology 2022Quote: ... were bred in house from breeders set up with C57BL6 mice purchased from Jackson Laboratory (Harbor, ME). Beddings of the cages harboring young and aged mice were exchanged once per week for at least 4 consecutive weeks to ensure the homogenization of microbiota ...
-
bioRxiv - Cell Biology 2022Quote: ... All mice were genotyped for Nox4 using primer sequences provided by Jackson Laboratory, and for Ltbp4 and mdx alleles using published genotyping primers (16).
-
bioRxiv - Neuroscience 2022Quote: ... Mice tail samples were genotyped using the following primers suggested by Jackson Laboratories: Piezo1-28247-forward ...
-
bioRxiv - Neuroscience 2023Quote: ... Genotyping for Cas9 transgene was performed with primer sequences provided by Jackson laboratories. All experiments were performed with approval of a local ethics committee (Bezirksamt Arnsberg ...
-
bioRxiv - Neuroscience 2023Quote: ... stock number: 008683) and primer sequences for genotyping were provided by Jackson laboratories. This breeding setup allowed us to use experimental cohorts that contained litter- and sex-matched mice randomly assigned to experimental groups ...
-
bioRxiv - Neuroscience 2020Quote: ... we set up timed matings of wild-type C57BL/6J mice (000664, The Jackson Laboratory, Bar Harbor, ME). At embryonic day (E ...
-
bioRxiv - Molecular Biology 2023Quote: ... Breeding was set up between Chchd10S55Lheterozygous (Het) males with wildtype (WT) C57BL/6NJ females (Jackson Laboratory, stock #005304). Tail DNA was extracted with a Promega kit and genotype was determined by sequencing services at Transnetyx ...
-
bioRxiv - Neuroscience 2023Quote: ... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
bioRxiv - Cell Biology 2021Quote: Mammary gland white adipose tissue (mgWAT) from RT or cold exposed mice (Jackson Laboratory, #000664) was dissected ...
-
bioRxiv - Neuroscience 2024Quote: ... Genotyping of the Y1-lox/lox was performed using primers and conditions provided by Jackson Labs. All other strains were genotyped by Transnetyx ...
-
bioRxiv - Cell Biology 2022Quote: ... Tissue sections were blocked for 2 hours at RT with 10% Donkey Serum (Jackson Laboratories, ME), 5% BSA (Sigma Aldrich) ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were washed with PBS and incubated for 1h at RT with secondary antibody (Jackson Laboratories) diluted in blocking solution ...
-
bioRxiv - Cell Biology 2022Quote: ... with additional internal control primers CTA GGC CAC AGA ATT GAA AGA TCT (oIMR7338; The Jackson Laboratory) and GTA GGT GGA AAT TCT AGC ATC ATC C (oIMR7339 ...
-
bioRxiv - Immunology 2021Quote: ... Tail DNA screening was performed using polymerase chain reaction for cre using primer sequences recommended by Jackson Laboratory (Forward ...
-
bioRxiv - Neuroscience 2021Quote: ... blocked for two hours at RT with Donkey anti-mouse IgG (Jackson Labs Catalog No.715-007-003); washed 3 times with TBS-T (.05% Tween ...
-
bioRxiv - Cancer Biology 2023Quote: ... slides were incubated for 1h at RT with secondary antibodies used at 1:250 dilution: anti-rat 405 (Jackson Lab), anti-rabbit 594 (Jackson Lab) ...
-
bioRxiv - Microbiology 2021Quote: ... and PCR genotyping undertaken as described (The Jackson Laboratory. Genotyping protocols database ...
-
bioRxiv - Neuroscience 2022Quote: ... and incubated with secondary antibodies in PTX at RT for 2 h: 1:200 Dylight 488 goat anti-chicken (Jackson lab), and 1:200 AlexaFluor 546 goat anti-mouse (ThermoFisher) ...
-
bioRxiv - Neuroscience 2022Quote: ... and were followed by 2 h incubation at RT in a biotinylated secondary antibody goat anti-rabbit (1:1000; Jackson Laboratories) in 0.1M PB ...
-
bioRxiv - Molecular Biology 2023Quote: ... the samples were washed three times with PBS and then incubated for 1hour at RT with secondary antibodies: anti-rabbit IgG Alexa Fluor 488 (1:500, Jackson lab), anti-mouse/chicken IgG Alexa Fluor 594 (1:500 ...
-
bioRxiv - Molecular Biology 2023Quote: ... the samples were washed three times with PBS and then incubated for 1hour at RT with secondary antibodies: anti-rabbit IgG Alexa Fluor 488 (1:500, Jackson lab), anti-mouse IgG Alexa Fluor 594 (1:500 ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Coat color was visually genotyped and the functional FVB/AntJ Pde6b allele was genotyped using primers recommended by Jackson labs (Supplemental Table 5). The mice were crossed to FVB/AntJ until the mutations were on a background homozygous for the FVB/AntJ coat color and Pde6b alleles.
-
bioRxiv - Neuroscience 2022Quote: ... After washing three times for 5 to 10 min with TBS/ 0.1% Tween20/ 3% milk at RT the membranes were incubated and shaken for 90 min at RT in 10 ml TBS / 0.1% Tween20 / 3% milk including 2 μL goat anti-rabbit IgG (Jackson Laboratories, Cat #115-035-045) and washed 4 times for 5-10 min each with TBS/ 0.1% Tween20/ 3% milk at RT ...
-
bioRxiv - Pathology 2021Quote: ... Genotype of Prrx1-ZsGreen mice were confirmed by PCR as recommended by Jackson Laboratory.
-
bioRxiv - Physiology 2022Quote: ... 5’- GACCATCAGCTGTCAGTACCC-3’ (Protocol 19216: Standard PCR Assay - Tgfbr1
, Jackson Laboratory, Bar Harbor, ME,USA). -
bioRxiv - Animal Behavior and Cognition 2024Quote: ... mutant mice were bred as heterozygotes at Nencki Institute and PCR genotyped (The Jackson Laboratory protocol). All of the mice for the behavioral studies were 4–7 months old at the time of training ...
-
bioRxiv - Cancer Biology 2020Quote: ... Sox9 genotypes were determined using the supplied protocol 29713 (standard PCR Assay - Sox9
, The Jackson Laboratory). Animal handlings and studies were performed according to the guidelines from the Finnish National Board of Animal Experimentation ... -
bioRxiv - Neuroscience 2023Quote: ... Tissue samples of offspring mice were subjected to a standard PCR genotyping assay (Jackson Laboratory genotyping protocol 23186). Four male and 4 female Nav1.9−/− mice were used in this study.
-
bioRxiv - Cell Biology 2021Quote: ... were either generated by heterozygous cross and genotypes confirmed via real time PCR according to Jackson Laboratories or directly purchased from Jackson Laboratories. Hyperglycemic db/db mice (ad lib fed blood glucose > 220 mg/dl ...
-
bioRxiv - Developmental Biology 2020Quote: ... FLP mediated recombination was confirmed by PCR and resultant progeny were mated with UCP1-Cre mice (B6.FVB-Tg(Ucp1-cre)1Evdr/J) from Jackson Lab. Unless otherwise stated ...
-
bioRxiv - Cell Biology 2021Quote: ... The primers for subsequent genotyping for TIGARf/f were listed in the Key Resources Table (KRT) and the mouse tail PCR (touchdown cycling protocol, Jackson Laboratory) results in 538 bp for mutant and 346 bp for wild type mice.