Labshake search
Citations for Sino Biological :
1 - 14 of 14 citations for hsa mir 30b RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR primers were from Sino Biological (Wayne, PA) or Genetimes ExCell (Hong Kong) ...
-
bioRxiv - Neuroscience 2024Quote: ... site directed mutagenesis was performed with primer set (forward: CATTGCCAAGGCTCTGCAGTCCATTGG; reverse: CTTCCGGTGGACTCATCT) using the full-length mouse Aldoa cDNA (Sino Biological Cat# MG52539-U) and Q5 Site-Directed Mutagenesis kit (New England Biolabs Cat# E0554S) ...
-
bioRxiv - Immunology 2022Quote: ... The human IL-15 ELISA Pair Set (Sino Biological) was used for the quantitative determination of IL-15 monomer.
-
bioRxiv - Immunology 2020Quote: ... Human CXCL9 qPCR primer pair (HP100773) and Human CXCL12 qPCR primer pair (HP100192) were obtained from Sino Biological Inc ...
-
bioRxiv - Neuroscience 2022Quote: ... or HIV-1 p24 ELISA pair set (Sino Biological Inc, SEK11695) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... The primers for murine RhoB were ordered from Sino Biological (MP202540, China). The sequence of primers for RPS9 were 5’-CTGGACGAGGGCAAGATGAAGC-3’ and 5’-TGACGTTGGCGGATGAGCACA-3’ (Eurofins Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... incubated for 1 hour at RT with 1:1,000 of anti-spike antibody (Rabbit MAb, Sino Biological, Beijing, CN) diluted in blocking buffer ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA synthesis was performed using recombinant HIV-1 RT subunits: (i) p51 (0.2475 µg) and p66 (0.2125 µg) from Sino Biological Inc (catalogue ...
-
bioRxiv - Cancer Biology 2023Quote: ... or Notch ligand fused with the Fc domain at a concentration of 10µg/ml for 6 h at room temperature (RT) (DLL1 Fc, 10184-DL-050 Biotechne; DLL3 Fc, DL3-H5255 ACRO Biosystems; DLL4 Fc, 158-10171-H02H-100 Sino Biological; JAG1 Fc ...
-
bioRxiv - Microbiology 2020Quote: ... the codon-optimized spike gene was PCR-amplified from a plasmid obtained from Sino Biological (VG40589-UT). This gene encodes a version of the Spike protein with amino acid identical to QHD43416.1 GenBank entry ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA fragments encoding human hSSB1 and INTS3 were amplified by PCR from NABP2- GFPspark plasmid (Sino Biological, HG22790-ACG) and INTS3- GFPspark plasmid (Sino Biological ...
-
bioRxiv - Microbiology 2020Quote: ... The SARS-CoV-2 S expression plasmid pC-SARS2-S was created by inserting the Acc65I/NotI-digested PCR-amplified SARS-CoV-2 S fragment of pCMV3-2019-nCoV-Spike(S1+S2)-long (Sino Biological; VG40589-UT) into the corresponding site of pCAGGS ...
-
bioRxiv - Microbiology 2020Quote: The pVSV-spike expression plasmid was constructed by PCR amplification of the full length human codon optimized spike gene from pCMV3-SARS-Cov-2 spike expression plasmid (Sino Biological, Cat #VG40588-UT) using the following primers ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... the pVSV-spike expression plasmid was constructed by PCR amplification of the full-length human codon-optimized S gene from pCMV3-SARS-CoV-2 S expression plasmid (Sino Biological, Cat# VG40588-UT) that was used to replace the VSV-G (Glycoprotein ...