Labshake search
Citations for New England Biolabs :
1 - 45 of 45 citations for pEGFP C2 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Isolated transcripts were ligated into pEGFP-C2 using Quick Ligation Kit (NEB), cloned into DH5α ...
-
bioRxiv - Molecular Biology 2021Quote: ... were cloned into pEGFP-C2 or pGEX5X.1 vector and transformed into NEB 10-beta competent E.Coli (New England Biolabs # C3019H). Mutagenesis to generate PARP1 ...
-
bioRxiv - Microbiology 2020Quote: ... rmdA into pMAL-c2 (NEB). rmdA G368G;G369G;D370A;E370A;F371F (rmdAGGAAF ...
-
bioRxiv - Plant Biology 2023Quote: ... or pMAL-C2 vector (NEB) in frame with an MBP tag ...
-
bioRxiv - Biochemistry 2024Quote: A pMAL-c2 plasmid (NEB) encoding an N-terminally 6xHis tagged MBP-MS2 fusion protein was transformed into E ...
-
bioRxiv - Plant Biology 2023Quote: ... and pMAL-c2 (New England Biolabs) to create translational fusion to the GST ...
-
bioRxiv - Cell Biology 2021Quote: ... with a destination vector modified from pMAL-c2 (NEB) by insertion of the Gateway cassette (ThermoFisher ...
-
bioRxiv - Biochemistry 2024Quote: ... constructs were generated in the vectors pMal-c2 (NEB), pGEX-2tk (GE Healthcare ...
-
bioRxiv - Cell Biology 2024Quote: ... The PCR products were introduced in pMal-c2 (New England Biolabs) expression vector through FastCloning [34] ...
-
bioRxiv - Plant Biology 2022Quote: ... For recombinant protein expression we used GW versions of pMAL-C2 (New England Biolabs) and pDEST-17 (Thermo Fisher ...
-
bioRxiv - Cell Biology 2024Quote: ... was inserted into an mCherry-C2 mammalian vector by Gibson assembly cloning (NEB, cat #E2611S); 2xFyve-GFP as described in (Gillooly 2000) ...
-
bioRxiv - Biophysics 2021Quote: ... Two of them correspond to two PCR-fabricated DNAs (C1 and C2) derived from lambda DNA (NEB) as template and including suitable restriction sites in the designed primers (Table S1) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The constructs encoding BE3 or SsCBE2-C2 were linearized using the PmeI restriction enzyme (NEW ENGLAND BioLabs). mRNAs of base editors and gRNA were synthesized in vitro from linearized DNA templates using the mMESSAGE mMACHINE T7 Ultra kit (Ambion ...
-
bioRxiv - Biophysics 2023Quote: ... The DNA fragment and the pEGFP-N1 backbone were digested using BsrGI-HF (#R3575SVIAL, NEB) and BamHI-HF (#R3136SVIAL ...
-
bioRxiv - Biophysics 2020Quote: ... The HCoV-229E and FIPV nsp5 coding sequences were cloned into pMAL-c2 plasmid DNA (New England Biolabs) for expression as MBP fusion proteins containing a C-terminal His6-tag ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR products harbouring PP1α87B coding sequence were cloned into StuI/XbaI sites of pMal-c2 (New England Biolabs) vector ...
-
bioRxiv - Cell Biology 2023Quote: ... The resulted PCR product co-transformed with pEGFP-C1-2µ-URA3 cut with BamHI (NEB, R3136) into yeast strain BY4743 (EUROSCARF Y20000 ...
-
bioRxiv - Biophysics 2023Quote: ... The DNA fragment and the SRC-EGFP-pEGFP-N1 backbone were digested using BsrGI-HF (#R3575SVIAL, NEB) and BamHI-HF (#R3136SVIAL ...
-
bioRxiv - Plant Biology 2021Quote: ... Constructs for protein expression in Escherichia coli (E. coli) were either inserted into a Gateway-cloning-compatible version of pMal-C2 (New England Biolabs, NEB) to create a fusion to the Maltose-binding protein (MBP ...
-
bioRxiv - Cell Biology 2024Quote: ... a PCR product containing the sequence encoding amino acids 104-330 of MPS1 from Drosophila melanogaster was inserted into the pMal-c2 vector (New England Biolabs) by FastCloning (Li et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... The amplicons were then cloned into the wild-type SsCBE-UGI-C2 vector using Gibson Assembly Master Mix (New England Biolabs). The cjSsCBE2 was constructed by exchanging APOBEC1 domain of cjCBEmax to SsdAtox-SRE domain ...
-
bioRxiv - Cell Biology 2024Quote: ... which was amplified from human cDNA library and cloning into pEGFP-N2 using Gibson assembly method (NEB E2611L). A stop codon was inserted before EGFP in pEGFP-N2 vector to clone untagged APMAPFL ...
-
bioRxiv - Biochemistry 2022Quote: ... The PCR product was ligated into the EcoRI and XbaI sites of the pMAL-c2 vector (New England Biolabs, Ipswich, MA). The resulting plasmid was transduced into E ...
-
bioRxiv - Plant Biology 2021Quote: ... Constructs for protein expression in Escherichia coli (E. coli) were either inserted into a Gateway-cloning-compatible version of pMal-C2 (New England Biolabs, NEB) to create a fusion to the Maltose-binding protein (MBP ...
-
bioRxiv - Cell Biology 2020Quote: Sec24D was subcloned from pEGFP Sec24D into pcDNA3.1 with an N-terminal myc-6xHis tag using Gibson Assembly (E5510, New England Biolabs). pcDNA3.1 was linearized with Not1 (R3189 ...
-
bioRxiv - Molecular Biology 2020Quote: ... we cloned the eGFP plasmid by restricting the pEGFP-RNASEH2A using HincII (New England Biolabs, Radnor, PA, cat # R0103S) that cut upstream and downstream of the RNASEH2A gene but leaves the EGFP intact ...
-
bioRxiv - Biochemistry 2024Quote: ... Plasmid pEGFP-C1 was used as a template in a PCR reaction using Q5 DNA polymerase (New England Biolabs) and oligonucleotides (5’-ACGCGTAAATTGTAAGCG-3’ and 5’-AACAACAACAATTGCATTCATTTTATG-3’ ...
-
bioRxiv - Plant Biology 2023Quote: The above-described cloned full length MpACL5 fragment was excised by XbaI and HindIII and transferred into the pMal-c2 vector (New England BioLabs, MA, USA) to generate pMal-MpACL5 construct ...
-
bioRxiv - Cancer Biology 2021Quote: ... mutant at A573D of AR-fl and AR-V7 in the pEGFP-C1 backbone were generated by site-directed mutagenesis using the Q5 site-Directed Mutagenesis Kit (New England BioLabs). The dimerization box (D-box ...
-
bioRxiv - Biophysics 2022Quote: Saturation mutagenesis of mEosEM at His63 was performed in the pEGFP-N1-mito-mEosEM plasmid with Q5 high fidelity polymerase (New England Biolabs). The amplified fragments containing homologous arms and mutation sites were transformed into the Top10 competent cells (Tsingke ...
-
bioRxiv - Developmental Biology 2022Quote: ... The resulting PCR fragment and the peGFP-N1-1 vector were sequentially digested with SalI and SacII prior to ligation with Quick ligase (New England Biolabs) to make a pcachd1-eGFP-N1-1 plasmid ...
-
bioRxiv - Biochemistry 2022Quote: The V7 variant of AR was generated from peGFP-C1-AR using the Q5 site-directed mutagenesis kit and primer design tools (New England BioLabs) with the following primer pair:
-
bioRxiv - Neuroscience 2022Quote: ... The N533H and L534I mutations in the pEGFP-SFPQ and pGEX6P1-SFPQ-276–598 constructs were generated with the Q5 site-directed mutagenesis kit (New England Biolabs). All constructs were verified by DNA sequencing ...
-
bioRxiv - Neuroscience 2024Quote: ... Subcloning PCR product and pEGFP-C1 backbone were cut using Kpn1-HF and Spe1-HF restriction enzymes (New England BioLabs) and ligated using Quick Ligase Kit (New England BioLabs ...
-
bioRxiv - Biophysics 2022Quote: ... The HiBit-Hsp70 insert was PCR-amplified directly from pEGFP-Hsp70 plasmid using primers containing the HiBit sequence and then inserted using AgeI and XbaI (NEB), which is SpeI compatible ...
-
bioRxiv - Biochemistry 2024Quote: ... was introduced into linearized pEGFP-C1 ΔSV40-Stop with Xho I and BamH I use the HiFi DNA Assembly Cloning Kit (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... The purified CASP3 gene fragment was ligated into the linearized pEGFP-N3 vector using the quick ligationTM kit according to the manufacturer’s instructions (NEB, B2200S). The resulting mixture was transformed into competent DH5α bacteria (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... The obtained pri-miRNA sequences were cloned into the pEGFP-N1 backbone vector by using AgeI and XbaI restriction enzymes and T4 DNA ligase (NEB BioLabs, USA). For shRNA overexpression ...
-
bioRxiv - Biochemistry 2020Quote: ... The PCR products were cloned into pEGFP-N2 vector using the XhoI and KpnI-HF or NheI and BamHI (New England Biolabs Inc.) restriction enzyme sites ...
-
bioRxiv - Developmental Biology 2020Quote: ... and mutated into a constitutively active form (pEGFP-C1-ERαY537S)29 using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs, E054S).
-
bioRxiv - Cell Biology 2023Quote: ... SEC61β-OPG was generated by PCR amplification using primers ATCACTCTCGGCATGGACGAGCTGTACAAGAGATCTATGCCTGGTCCGACC and GGTATGGCTGATTATGATCAGTTATCTAGATTACCCTGTCTTATTGCTAAATGGA AC and the obtained product was co-transformed with pEGFP-C1-2µ-URA3 cut with BamHI (NEB, R3136) into yeast strain BY4743 (EUROSCARF Y20000 ...
-
bioRxiv - Neuroscience 2022Quote: ... Deletion mutant EGFP-Inka2ΔiBox and EGFP-Inka2ΔCC were constructed from pEGFP-Inka2 using Q5 Site-Directed Mutagenesis Kit (New England BioLabs, Ipswich, MA, USA). Expression plasmids for Pak1 (pCMV6M-Pak1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 60 containing human RNaseH1 with D210N catalytic dead mutant was amplified by PCR for cloning in pEGFP-N1 using EcoRI (NEB, #R3101S) and KpnI (NEB ...
-
bioRxiv - Biochemistry 2024Quote: ... and the insert was cut out and ligated into pEGFP-N1 plasmid prepped from a dam- dcm- E.coli strain (New England Biolabs Cat# C2925H) and digested with NheI and XbaI ...
-
bioRxiv - Molecular Biology 2020Quote: ... The obtained pri-miRNA sequences were cloned into the pEGFP-N1 backbone vector by using AgeI and XbaI restriction enzymes and T4 DNA ligase (NEB BioLabs, USA). For shRNA overexpression ...