Labshake search
Citations for New England Biolabs :
301 - 350 of 4567 citations for 3 1 Pyrrolidinylmethyl phenyl magnesium bromide solution since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... 3 μl of PvuI (NEB, Cat. R3150S) PacI (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... 10% NEBuffer 3 (New England Biolabs, #B7003S) in a thermocycler at 85°C for 3 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Then 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Genomics 2023Quote: ... 3 µl of Lambda Exonuclease (NEB, #M0262L), and 3 µl of Exonuclease I (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Biochemistry 2024Quote: ... Then 3 µL USER Enzyme (NEB, USA) was used with size selected ...
-
bioRxiv - Cancer Biology 2024Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Systems Biology 2024Quote: ... then 3 μL of USER enzyme (NEB) was added and mixed again by pipetting ...
-
bioRxiv - Genomics 2024Quote: ... 3 μl each of HinP1I (NEB R0124S), DdeI (NEB R0175L) ...
-
bioRxiv - Cell Biology 2024Quote: ... Then 3 ml USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Immunology 2024Quote: ... and Klenow Fragment (3’-5’ exo-) (NEB) and mixed by gentle tapping ...
-
bioRxiv - Genomics 2024Quote: ... and 2 µL 10x NEBuffer 3 (NEB) in a total volume of 20 µL and was incubated for 40 min at 37 °C and 60 min at 45 °C ...
-
bioRxiv - Genomics 2024Quote: ... and 3 µL 10x ThermoPol buffer (NEB) were added for final volume of 30 µL ...
-
bioRxiv - Genomics 2024Quote: ... and 3 µL 10x NEBuffer 2 (NEB) were added for a final volume of 30 µL ...
-
bioRxiv - Genetics 2024Quote: ... 3 µL of rCutSmart Buffer (NEB, B6004S) and 3 µL nuclease-free water were added before the Cas9 digestion ...
-
bioRxiv - Bioengineering 2024Quote: ... 3 μL 10X rCutSmart buffer (NEB, B6004S), H2O to 30 μL incubated at 37°C for 10 min and heat inactivated at 80°C for 2 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... Then 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1-5 μM SNAPf fused activator was incubated in a 1× PBS solution containing up to threefold excess of SNAP-surface 649 (New England BioLabs, #S9159S), 1 mM DTT ...
-
bioRxiv - Developmental Biology 2023Quote: One-cell stage zebrafish embryos were injected with 1-2 nl of injection solution containing 300 ng/μl of Cas9 enzyme (NEB# M0646T) and 12.5 ng//μl of sgRNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... the tissue samples were stained using Vizgen’s Cell Boundary Kit (Vizgen, 10400009) and blocked in blocking solution (Vizgen, 20300012) supplemented with a 1:20 dilution of Rnase inhibitor (NEB, M0314L) for one hour ...
-
bioRxiv - Molecular Biology 2024Quote: ... This incubation was repeated with a 1:200 pA-Dam solution (equivalent to nearly 60 Dam units, determined by calibration against Dam enzyme from NEB, #M0222L), followed by two wash steps ...
-
bioRxiv - Genomics 2024Quote: ... This incubation was repeated with a 1:200 pA-Dam solution (equivalent to nearly 60 Dam units, determined by calibration against Dam enzyme from NEB, #M0222L), followed by two wash steps ...
-
bioRxiv - Systems Biology 2021Quote: ... 0.4μL 10 mM dNTP Solution (New England Biolabs), 4μL 5x Phusion HF Buffer (Thermo Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 200 μM dNTP Solution Mix (New England Biolabs), and a concentration of biotin-11-dNTPs (PerkinElmer ...
-
bioRxiv - Developmental Biology 2022Quote: ... 20μl of extraction solution (25μl of PK (NEB) /ml of NP40 lysis buffer ...
-
bioRxiv - Molecular Biology 2023Quote: Proteinase solution: 4 μL proteinase K (NEB, P8107S) was added into 1 mL 0.1 M Tris-HCl 0.05 M EDTA (pH 8.0 ...
-
bioRxiv - Biophysics 2023Quote: ... with the following: 3.2 μL solution A (NEB), 1 μL factor mix (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2.5μl Deoxynucleotide (dNTP) Solution Mix (New England Biolabs), 0.5μl P5 primer pool ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Adenosine was added to the 3’ end of the DNA fragments using Klenow (3’-5’ exo-) (New England Biolabs). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... and a 956 bp fragment of omp-pst2 gene was amplified using the primers OmpPst2_F4qs (5’-ATTATTCGCGGCGGGTGTTAC-3’) and OmpPst2_R4qs (5’-CAGCGGCCATATTCTTGTTGA-3’) using the Q5 High-Fidelity DNA Polymerase (New England BioLabs). The PCR program consisted in an initial step at 98°C for 5 min ...
-
bioRxiv - Microbiology 2022Quote: ... Briefly 5 µg pAc CrPV 5’UTR-1A-GFP-3’ or pCrPV-3 plasmids were linearized with Eco53KI (NEB) or 5 µg pTOPO dsRNA plasmids with EcoR1 (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... Adenosine was added to the 3’ end of the DNA fragments using Klenow (3’-5’ exo-) (New England Biolabs). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Microbiology 2021Quote: ... and a total of 20 μg were ligated with 50 pmol 3′adaptor Linker (5′-rAppCTGTAGGCACCATCAAT–NH2-3′; NEB) via a 16 h incubation at 16°C using 20 U T4 RNA ligase (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: ... pCMV-hnCoV-S-H501Y-Δ69/70 was obtained from pCMV-7.1-hnCoV-S-H501Y (forward: 5’-TCCGGCACAAACGGCACA-3’, reverse: 5’-GATGGCGTGGAACCATGTC-3’) via Q5 SiteDirected Mutagenesis Kit (NEB). All plasmids were confirmed by gene sequencing (BGI Beijing) ...
-
bioRxiv - Microbiology 2023Quote: ... PM (5’-GACCCCGTTGACAGCG-3’) and PMrev (5’-TGGAACACCTGGCGGAAA-3’) with T4 polynucleotide kinase (0.075 U/µL) (New England Biolabs) and [g32P]-ATP (3000 Ci/mmol ...
-
bioRxiv - Bioengineering 2024Quote: ... 5’-AGCTACCGACAACAACGTGT-3’ and Cap9_ Kpn/Age_Rev: 5’-AGAAGGGTGAAAGTTGCCGT-3’ and Phusion High-Fidelity PCR kit (New England Biolabs). The amplicon was gel purified digested with KpnI ...
-
bioRxiv - Microbiology 2021Quote: ... was ligated with the digested vector in a ratio of 3:1 using the Gibson assembly ligation matrix mix (NEB E5510S). Each ligation reaction was incubated for 1 hour at 50 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... where 200pmol 5’-adenylated,3-dideoxyC DNA adapters (Table 1) were ligated with 400U truncated T4 RNA ligase 2 (NEB M0242) in 1X ATP-free T4 RNA ligase buffer [50mM Tris pH 7.5 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 μl of RNA were mixed with 2 μl of 100 μM PvG748-SBS12-RT random hexamer primer (Supplementary Table 3) and 1 μl of 10 mM dNTP mix (NEB, N0447S), incubated for 3 minutes at 65 °C and transferred to ice ...
-
bioRxiv - Cell Biology 2022Quote: ... TSF-ATG101:ATG13 (1-197) complex (final 3 μM) were incubated with 30 μl Amylose resin (New England Biolabs, Ipswich, MA) at 4 °C overnight in the ITC buffer ...
-
bioRxiv - Developmental Biology 2022Quote: ... the cells were washed 3 times with PBS and permeabilized 5 min on ice with permeabilize sol (1xPBS, 1%RNAse inhibitor Ribovanadylcomplex (RVC, NEB,#S1402S), 0,5 % Triton X-100 (Sigma ...
-
bioRxiv - Genomics 2022Quote: ... The RNA was removed from beads by Trizol and then followed with the 3’ adapter ligation using T4 RNA Ligase 1 (NEB M0204L). After this ...
-
bioRxiv - Genomics 2022Quote: ... the SapI sgRNA expression cassette was ligated into the KpnI linearized PX458 in a 3:1 molarity ratio using T4 DNA-ligase (New England Biolabs, M0202S) according to the manufacturer’s instructions followed by transformation and Sanger sequencing to verify successful cloning ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The ligation was performed at a 3:1 insert-to-vector ratio and by using T4 DNA ligase (New England Biolabs, USA) for 16 hours at 16 °C according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... were obtained from HeLa cells co-transfected with mGFP-Sec16L at 3 µg/µL and FLAG-TFG-SNAP at 1 µg/µL and subsequently labeled with SNAP-Cell 647-SiR (NEB, S9102S) and immunostained with anti-GM130 ...
-
bioRxiv - Genetics 2023Quote: ... 600 ng linearized plasmid backbone and 48 ng of digested library (molar ratio of 1:3) were ligated with 5 μL (2000 U) of T4 DNA ligase (NEB M0202S) in a 100 μL reaction ...
-
bioRxiv - Microbiology 2024Quote: ... N-4005, and N-4004) were used to cap available 3’-terminal ends using terminal transferase (1 µl, 20 units) (NEB #M0315S), TdT reaction buffer (1.5 µl) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Single turnover reactions were carried out as follows: 5 µM Clr4 was preincubated 5 minutes with 1 mM final S-adenosyl-methionine (liquid SAM, 3 2mM, NEB #B9003S), and varying concentrations of pSwi6 or unP Swi6 ...