Labshake search
Citations for New England Biolabs :
301 - 350 of 4673 citations for 2 Amino 3 chloro 5 nitro 6 picoline since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... Singlet and duplet pools were A-tailed using using Klenow HC 3’→5’ exo- (#M0212L; NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ and 3’ homology arms and the insert were cloned into the pUC19 vector (NEB, #N3041S) by using Gibson Assembly Master Mix (NEB ...
-
bioRxiv - Biophysics 2022Quote: ... The gene sequences were flanked by restriction enzyme sites for 5’ NdeI and 3’ EcoRI (NEB). Genes were cloned into pET21a using standard protocols from NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by dA tailing with 0.25 U/µL Klenow (3′→5′ exo-) (New England Biolabs, M0212) in the presence of 0.5 mM dATP (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was 5’-labelled with 20 U of T4 Polynucleotide Kinase (3’ phosphatase minus) (NEB # M0236S) and 50 pmol of (gamma-32P)ATP (Perkin Elmer ...
-
bioRxiv - Neuroscience 2024Quote: ... Reverse: 5’-GCTGCCAGTCCAATAGAGGG-3’) were used with the Luna Universal One-Step RT-qPCR Kit (NEB) with SYBR Green detection on the CFX96 (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... and 0.15mM of 7-deaza-dGTP (7-deaza-2′-deoxyguanosine 5′-triphosphate, NEB).
-
bioRxiv - Microbiology 2024Quote: ... 5 mM MgCl2 and 2 U of recombinant Escherichia coli RNase HI (NEB) were added ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 and 5 minutes by the addition of 0.8 units Proteinase K (NEB). Fragments were resolved on 1% agarose gel and band intensities were quantified on Image Lab (BioRad).
-
bioRxiv - Bioengineering 2022Quote: ... 1X of a restriction enzyme mix [1/2 EcoRI-HF® (NEB #R3101, 2/5 Nuclease-free water, 1/10 CutSmart Buffer 10X (NEB)] ...
-
bioRxiv - Biochemistry 2020Quote: ... α1- 3,4,6), 10 U β-galactosidase (P0726S, β1-3) and 8 U β-galactosidase (P0746S, β1-3,4) (all from New England BioLabs, USA). All reactions were performed in a final volume of 10 μl in 50 mM sodium acetate buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... A preadenylated universal linker (5’-rAppCTGTAGGCACCATCAAT-NH2-3’) was prepared in house or purchased from NEB (S1315S) and ligated to the 3’ ends of the dephosphorylated footprints using T4 RNA Ligase 2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... two oligos (see Supplementary Table 3) were annealed and 5’ phosphorylated (T4 Polynucleotide Kinase kit, M0201S, NEB) as described previously (LentiGuide-Puro and LentiCRISPRv2) ...
-
m7G cap-eIF4E interaction stimulates polysome formation by enhancing first-round initiation kineticsbioRxiv - Biophysics 2021Quote: ... 5’-end capping and 3’-end biotinylation were performed using the Vaccinia Capping System (New England Biolabs) and the Pierce RNA 3’ End Biotinylation Kit (Thermo Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... 3 µl Antarctic phosphatase [5 U] and 7.32 µl Antarctic phosphatase buffer (both New England BioLabs, Germany). The reaction was heat-inactivated at 85°C during 15 min ...
-
bioRxiv - Microbiology 2022Quote: ... as follows: 1µL of 2µM MBTUni-12 primer (5’-ACGCGTGATCAGCRAAAGCAGG-3’) + 1µL 10mM dNTPs Mix (NEB #N0447S) + 8µL Nuclease-free water (Ambion ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse primer Y111E: 5’-TTGATGGAGACATTCTTC-3’) using the Q5 site-directed mutagenesis kit (E0554S, New England Biolabs) to generate a point mutant ...
-
bioRxiv - Biophysics 2021Quote: ... 5′-end capping and 3′-end biotinylation were performed using the Vaccinia Capping System (New England Biolabs) and the Pierce RNA 3′ End Biotinylation Kit (Thermo Scientific) ...
-
bioRxiv - Biochemistry 2024Quote: ... which was dephosphorylated at the 5’-end with 3 µl of Quick-CIP (5000 U/µl, NEB) in a total volume of 20 µl according to manufactureŕs instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA fragments were directly 3’-end dephosphorylated using 5 U of Antarctic Phosphatase (New England Biolabs, UK) for 30 minutes at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... CVO689-CVO586 (integrant 5’ end) and CVO321-CVO183 (integrant 3’ end) using Q5 Polymerase (New England Biolabs). PCRs were set up according to manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Products were then ligated to 3’ adaptor (/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) by T4 RNA ligase 2(NEB) and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Vcan exon 2 and exon 3 were amplified using Phusion Taq (NEB, catalog no. F530L) (see SI) ...
-
bioRxiv - Biochemistry 2023Quote: ... The tRNA 2’-3’ cyclic phosphate was removed by treatment with T4 PNK (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... and ligated to the 3′ adapter by incubating with T4 RNA ligase 2 truncated mutant (NEB) and 1 µg of pre-adenylated adapter (5′rAppCTGTAGGCACCATCAAT/3ddc ...
-
bioRxiv - Biochemistry 2024Quote: ... the RNA was ligated to the 3′ adaptor tRNA using T4 RNA ligase 2 (NEB, M0351L) for 2 h at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... The 5’ and 3’ arms (5 to 8 kb) were amplified from a C57Bl/6 BAC clone by PCR using Q5 polymerase (New England Biolabs) and inserted into a cloning vector that contains frt-flanked SV-Neo for positive selection and Pgk-DTA and HSV-TK genes for negative selection (Jarvie et al. ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 μl of the assembly reaction was transformed into 5 μl chemically competent cells (E. coli NEB 5-alpha, New England Biolabs). Circuit constructs were analyzed by PCR ...
-
bioRxiv - Genetics 2020Quote: ... A 6 µL mixture containing 2 µL of 40 µM Spy Cas9 NLS protein (New England Biolabs, MA, USA), 200 ng each of five sgRNAs (in 2 µL ...
-
bioRxiv - Physiology 2021Quote: ... 5’ end repair was done using T4 PNK with 2 mM ATP (NEB P0756S). Following RNA purification with Zymo Oligo Clean & Concentrator (D4060) ...
-
bioRxiv - Developmental Biology 2023Quote: ... On-Bead 5’ Decapping reaction was done using NEBuffer 2 buffer (NEB, B7002S ®). Off-Bead Reverse Transcription followed the instructions in SuperScript ® IV Reverse transcriptase kit ...
-
bioRxiv - Microbiology 2022Quote: ... 2 μg RNA were incubated for 30 minutes at 37°C with 2 μl RNA 5’ Pyrophosphohydrolase (NEB, M0356, 5,000 units/ml). The reactions were stopped by cleaning up the samples following the ZYMO RNA Clean & Concentrator-5 kit (ZYMO ...
-
bioRxiv - Molecular Biology 2024Quote: ... attB plasmid containing genes for tdMCP-protein fusions and a MS2-circRNA barcode were digested overnight at 37°C to remove existing barcode sequence (2 μg plasmid, 5 μL 10x CutSmart buffer, 2 μL BsrGI-HF (NEB cat#R3575S), nuclease-free water to 50uL) ...
-
bioRxiv - Molecular Biology 2024Quote: ... was digested by combining the following and incubating overnight at 37°C: 2 μg plasmid + 5 μL CutSmart buffer (10x) + 2 μL AflII (NEB cat# R0520S) + 2 μL BlpI (NEB cat# R0585S ...
-
bioRxiv - Genomics 2021Quote: ... the purified products are treated with Klenow fragment (3’ → 5’ exo-) (Cat. No. M0212L; NEB; use 1 uL) and Taq DNA polymerase (Cat ...
-
bioRxiv - Neuroscience 2021Quote: NFIB 3’ UTR and 5’ UTR HP forming regions were in vitro transcribed using T7 transcriptase (NEB, E2040) and purified with Trizol extraction (described in RT-qPCR paragraph) ...
-
bioRxiv - Genomics 2020Quote: ... RNA was resuspended in 5 μl of water and the 3′ ends dephosphorylated with PNK (New England BioLabs) in MES buffer (100 mM MES-NaOH ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5µL of 10µM MBTUni-12 primer + 2.5µL of 10µM MBTUni-13 primer (5’-ACGCGTGATCAGTAGAAACAAGG-3’) + 10µL 5x HF Phusion Buffer + 1µL 10mM dNTPs mix (NEB #N0447S) + 0.5µL Phusion Polymerase + 28.5µL of Nuclease-free water (Ambion ...
-
The absence of C-5 DNA methylation in Leishmania donovani allows DNA enrichment from complex samplesbioRxiv - Molecular Biology 2020Quote: ... and cloned between 300 bp of PCR amplified DNA fragments of the LdBPK_250018100.1 5’ and 3’ UTR using NEBuilder (NEB) inside pUC19 for construct amplification in E ...
-
bioRxiv - Molecular Biology 2021Quote: ... R: 5’-ccgggaaaaactgaaaaaccattggcacgacaggtttcccgac-3’ from the pKAM555 vector) was inserted at the ClaI site using HiFi assembly (NEB). For the intTEL0 strain creation the pUC19LG plasmid (lacking the PstI(blunted)-BclI fragment of the HARS36 sequence ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 µl of 100 mM dATP solution and 2.5 µl of Klenow Fragment (3′->5′ exo-) (NEB, #M0212L) were added to the mixture ...
-
bioRxiv - Genetics 2022Quote: ... The second strand cDNA synthesis was performed using Klenow fragment 3’-5’ exo (New England Biolabs Inc, USA), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... A single adenine base was added to fragment ends by Klenow fragment (3′ to 5′ exo minus; NEB), followed by ligation of Illumina adaptors (Quick ligase ...
-
bioRxiv - Microbiology 2022Quote: ... Either 3-5 µL of Color Prestained Protein Standard-Broad Range (11-245 kDa) (New England Biolabs, P7712) or 1-3 µL of PageRuler Prestained Protein Ladder (10-180 kDa ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was resuspended in 5 μl of water and the 3′ ends dephosphorylated with PNK (New England BioLabs) in MES buffer (100 mM MES-NaOH ...
-
bioRxiv - Molecular Biology 2024Quote: ... using ETAA1 DBR R1 RT-PCR primer 5′-AAGTTCTTCTTCTTGACTTTGTGTT-3′ and treated with RNaseH (New England Biolabs, M0297S). 1μl of the cDNA was used for PCR amplification reactions using using GoTaq® G2 DNA Polymerase (Promega ...
-
bioRxiv - Genomics 2024Quote: ... followed by 5’ end phosphorylation of cleaved target RNAs with T4 polynucleotide kinase (PNK, 3’ -phosphatase minus, NEB)) ...
-
bioRxiv - Microbiology 2024Quote: ... This plasmid was digested using XbaI and BstXI (5’ tag) or HindIII and SpeI (3’ tag) enzymes (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... the fragments were repaired and A-tailed using 15 units of Klenow 3’-5’ exo-(New England Biolabs). After End-repair and A-tailing ...
-
bioRxiv - Cancer Biology 2021Quote: ... ΔN1/2/3 and ΔDAD mutants were generated by Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) with HOXB13 WT or NCOR1 WT as a template ...