Labshake search
Citations for New England Biolabs :
201 - 250 of 6524 citations for 2 Bromo 1 5 bromofuran 2 yl ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... After 2 U RNase H (NEB) treatment for 15 min at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl T4 ligase buffer (NEB), 1 μl T4 ligase (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 µl 5x Q5 buffer (NEB), 0.2 µl 10 mM dNTPs (NEB) ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μL PNGase F (NEB # P0704) was added to the filter and incubated for 3 h at 37 °C ...
-
bioRxiv - Biophysics 2021Quote: ... and 2’-O-methyltransferase (NEB, M0366), following the one step protocol ...
-
bioRxiv - Microbiology 2023Quote: ... containing 1x NEBuffer 2 (NEB, B7002S), 1 mM ATP ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µg bovine serum albumin (NEB), 10% glycerol (v/v ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 μL GlycoBuffer 2 (10 ×) (NEB), 10 μL 10% NP-40 (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... 2 (TOYOBO) and BsaI-HF (NEB) and incubated at 37℃ for 5 min and 16℃ for 5 min for three cycles ...
-
bioRxiv - Zoology 2022Quote: ... mRNA cap 2’-O-methyltransferase (NEB) and E ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 µl T4-PNK buffer (NEB), 2 µl T4-PNK (10 U/µl ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 µl Q5 DNA Polymerase (NEB). Amplification was done with an initial denaturation at 95 °C for 30 sec followed by 40 cycles at 95 °C for 10 sec ...
-
bioRxiv - Biophysics 2022Quote: ... and 2 U/mL YIPP (NEB).50 Af tRNA nucleotidyl transferase was purified with the same method and buffers as the MBP-MS2 fusion protein.38 The reaction was incubated at 37 °C for 2 hours ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 U M.CviPI (NEB, Cat# M0227S), 160 μM S-adenosylmethionine (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 µl of 10X buffer (NEB), and 833 µM of cytidine 3’-phosphate at 37° C for 1 hour ...
-
Promoter-adjacent DNA hypermethylation can downmodulate gene expression: TBX15 in the muscle lineagebioRxiv - Molecular Biology 2022Quote: ... pCMV-CLuc 2 (New England Biolabs) encoding the Cypridina luciferase was co-transfected with the test construct ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2µl 10× GlycoBuffer 2 (NEB) buffer at 37°C 1h ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µl 10% NP-40 (NEB) and 2µl 10× GlycoBuffer 2 (NEB ...
-
bioRxiv - Genetics 2024Quote: ... 2 µl Cas9 Protein (M0386, NEB), 0.5µl buffer (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... 0.5 µL 10x NEBuffer 2 (NEB), 0.8 µL 8-HQ (500 µM ...
-
bioRxiv - Genomics 2024Quote: ... 0.5 µL 10x NEBuffer 2 (NEB), 1.3 µL water and 0.2 µL Therminator IX (NEB ...
-
bioRxiv - Immunology 2024Quote: ... 2 × RNA loading dye (NEB, #B0363S) were added to the system to stop the reaction and the RNA was separated by agarose gel electrophoresis.
-
bioRxiv - Molecular Biology 2024Quote: ... + 2 μL BlpI (NEB cat# R0585S) + nuclease-free water to 50 μL ...
-
bioRxiv - Microbiology 2024Quote: ... 2 U of quick CIP (NEB), and water as needed ...
-
bioRxiv - Molecular Biology 2024Quote: ... T4 RNA ligase 2 (M0239S, NEB), Leupeptin (PI78435 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 mM Vanadyl ribonucleoside complex (NEB), 2X SSC ...
-
bioRxiv - Genomics 2024Quote: 2 μL USER enzyme (NEB #M5505) was added to each PCR amplification reaction containing deaminated DNA library ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 2 mM VRCs (NEB # S1402S) were added ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 µL 10 mM dNTPs (NEB), and 1 µL DNA Polymerase I ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 µL SUPERase•In RNase Inhibitor and 1 µL T4 RNA Ligase 2 truncated KQ (NEB, M0373L) were added to the RNA-adapter mixture ...
-
bioRxiv - Molecular Biology 2021Quote: ... and NEBNext Multiplex Oligos for Illumina Primer sets 1 and 2 (New England Biolabs). The libraries were amplified with 7 PCR cycles using Herculase II Fusion Polymerase kit (Agilent) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1 μL RT Adapter (RTA)(SQK-RNA002) and 2 μL T4 DNA Ligase (NEB) were mixed together and incubated under 25 °C for 10 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... and NEBNext Multiplex Oligos for Illumina (NEB Set 1 E7335 and Set 2 E7500S). Additional AMPure clean-ups at the start and the end of library preparation were included ...
-
bioRxiv - Microbiology 2022Quote: ... and 1 μl T4 RNA ligase 2 (truncated K227Q, NEB, M0242, 200,000 units/ml) and incubated at 16°C for 14 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... Resulting PCR amplicons were denatured and re-annealed in 1 × NEB buffer 2 (NEB) in a total volume of 9 μl using a following conditions ...
-
bioRxiv - Genomics 2023Quote: ... 20 of 2 U µL-1 Phusion High-Fidelity DNA Polymerase (New England Biolabs), 160 µL of 40 U µL-1 Taq DNA ligase (New England Biolabs ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 µL of Buffer 2 and 0.5 µL of rSAP (New England Biolabs, M0371S) pre-mixed with 0.5 µL of 50% glycerol were added ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl 10 pM/μl TrAEL-seq adaptor 1 and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L). Plugs were then rinsed with 1 ml tris buffer ...
-
bioRxiv - Microbiology 2020Quote: ... Two and a half μL of each fragment at equimolar concentration was added to 5 μL 2× Gibson master mix (NEB), and the mixture was incubated at 50°C for 60 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gluc200 and Gluc200A44 templates were generated using PCR amplification of GLuc of the first 200 nt at the 5’end of pCMV-GLuc 2 Control Plasmid (NEB: https://www.neb.com/tools-and-resources/interactive-tools/dna-sequences-and-maps-tool) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the NIR fluorescent adaptor (5′-OH-AGATCGGAAGAGCGGTTCAGAAAAAAAAAAAA/iAzid eN/AAAAAAAAAAAA/3Bio/-3′) was ligated to the RNA using truncated RNA ligase 2 K227Q (NEB) overnight at 16°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... NC-siRNA sense: 5’-AGGUAGUGUAAUCGCCUUGdTdT-3’.35,36 NEBuffer™ 2 and nucleoside digestion mix were obtained from NEB (Ipswich, MA). Adenosine and N6-methyl adenosine (m6A ...
-
bioRxiv - Genetics 2022Quote: ... 2 μg of DNA was digested with 50 units of DpnII and 5 μL NEBuffer™ DpnII (NEB, cat #R0543L), in a total volume of 50 μL ...
-
bioRxiv - Biochemistry 2023Quote: Transcription reactions were prepared at room temperature in 20 µL transcription buffer (40 µM Tris-HCl pH 8, 5 mM DTT, 10 mM MgCl2) with 2 mM NTP’s (NEB, N0450S) and 40 U/µL RNasin™ Plus (Promega ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5 mM each of forward and reverse primers (Supplemental Table 2) and 0.5 U Phusion® HF DNA polymerase (NEB) in a reaction volume of 25 μl ...
-
bioRxiv - Cell Biology 2023Quote: ... The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’; IDT) by T4 RNA ligase 2(NEB). The 5’ adaptor containing 6 nt barcode was ligated using T4 RNA ligase 1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 5-7 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Biochemistry 2024Quote: Fab Fragments were generated by taking .5 mg of IgG and digesting with 2 µL of Lys C (NEB#P8109S) at 37℃ ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...