Labshake search
Citations for New England Biolabs :
151 - 200 of 5800 citations for 3 2 Isopropylphenyl 1 propene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3’ end using T4 RNA ligase 2 truncated KQ (NEB, M0373L). Linker-ligated RNA was reverse transcribed with Protoscript II (NEB ...
-
bioRxiv - Genomics 2023Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3’ end using T4 RNA Ligase 2 truncated KQ (NEB, M0373L).
-
bioRxiv - Developmental Biology 2023Quote: ... the tbb-2 3’UTR sequence was amplified from genomic DNA using PCR and primers 5’-tggatgaactatacaaatagatgcaagatcctttcaagca-3’ and 3’-aggttttcaccgtcatcacccgcgaaaaacccatgtaagt-5’ and the vector containing the sequence of pie-1p::his-15::gfp amplified from plasmid containing pie-1p::his-15::gfp::egg-6 3’UTR using PCR and primers 5’-ggtgatgacggtgaaaacct-3’ and 3’-ctatttgtatagttcatccatgcc-5’ were used to generate pie-1p::his-15::gfp::tbb-2 3’UTR by using Gibson assembly (NEB E2611). To add the wild type or mutant 3xmir-51 seed sequences ...
-
bioRxiv - Cell Biology 2024Quote: ... were then ligated to pre-annealed Nano-tRNAseq 5’ and 3’ RNA adapters at room temperature for 2 hours with 20% PEG PEG 8000 (NEB, B10048) using recombinant E ...
-
bioRxiv - Cell Biology 2021Quote: ... RHA PCR products were ligated into pAAV p21 vector by Gibson assembly at a ratio vector:inserts of 1:2:2 using T4 DNA ligase (NEB). All constructs were checked by sequencing before transfection into cells ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 μl each of two complementary oligonucleotides (Mut_sgRNA_F and Mut_sgRNA_R) (Supplementary file 1) at a concentration of 20 μM and 2 μl of NEBuffer 2 (NEB B7002S) were added into an Eppendorf tube ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 μL of 2-Log DNA Ladder (200 μg/mL; NEB) is mixed with 1 μL of Gel Loading Dye (6x ...
-
bioRxiv - Genomics 2021Quote: ... 2 μL of 1 mg/ml bovine serum albumin solution (NEB), 1 μL of hOGG1 (ProSpec TechnoGene Ltd. ...
-
bioRxiv - Microbiology 2020Quote: ... 1–2 mg of RNA was treated with DNAse I (NEB), x µL and 2 µL of this reaction was used to make cDNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 ul of micrococcal nuclease (Biolabs M02475, 2×106 U/ml) was added to 200 μl buffer containing 1 mM CaCl2 and incubated for 10 min 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... 1× LongAmp® Taq 2× Master Mix (New England Biolabs, UK), and 2 μL of a unique barcode ...
-
bioRxiv - Biophysics 2023Quote: ... and 5 U Klenow in 1× NEBuffer 2 (New England BioLabs) (120 μL total volume ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L). Plugs were then rinsed with 1 ml Tris buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... Primers Set 1 and 2 (NEB, cat. no. E7335 and E7500). We proceeded by pulling the samples together ...
-
bioRxiv - Genomics 2021Quote: ... End fill-in and A-tailing were performed by addition of Klenow Fragment 3’ --> 5’ exo-(Enzymatics) and dNTP mix (10 mM dATP, 1 mM dCTP, 1 mM dGTP New England Biolabs). After ligation to methylated Illumina TruSeq LT v2 adaptors using T4 DNA Ligase rapid (Enzymatics) ...
-
bioRxiv - Biochemistry 2021Quote: ... were 3′ end-radiolabeled by incubation for 1 hr at 16°C with 1.11 MBq [5′-32P] cytidine-3′,5-bisphosphate (222 TBq mmol−1, Hartmann Analytic) and 10 units T4 RNA ligase 1 (NEB) in a total reaction volume of 20 µl containing 15% (v/v ...
-
bioRxiv - Biochemistry 2023Quote: ... were ligated to 50 pmol RNA oligonucleotide “20.25” (5’-UCG AAG UAU UCC GCG UAC GU-3’, Dharmacon) with 1 µL T4 RNA ligase 1 (NEB, #M0204S) for 1 h at 16 °C in 15% (v/v ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1.4 units μL−1 T7 RNA polymerase (RNAP, NEB 2 units μL−1 RNase inhibitor (NEB), 50 nM Cas9 (NEB) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1.4 units μL−1 T7 RNA polymerase (RNAP, NEB 2 units μL−1 RNase inhibitor (NEB), 50 nM Cas9 (NEB) ...
-
bioRxiv - Genomics 2021Quote: ... 1 μl of RNAse inhibitor and 3 μl of Antarctic phosphatase (New England BioLabs Inc.). We then performed a kinase treatment adding 4 μl of T4 Polynucleotide Kinase (PNK ...
-
bioRxiv - Genomics 2021Quote: ... The 3′ adapter (sequence: AGATCG-GAAGAGCACACGTCTGAACTC) was ligated using T4 RNA Ligase 1 (NEB, M0204L) and purified nascent RNA using streptavidin beads (NEB ...
-
bioRxiv - Systems Biology 2024Quote: ... and NEBNext Multiplex Oligos for Illumina Index Primers Set 1 and 3 (NEB E7335S, E7710S) and PCR-amplified for 15 cycles ...
-
bioRxiv - Biochemistry 2024Quote: ... In short 5’-phosphorylated and 3’-OH RNA was circularized with RNA ligase 1 (NEB) followed by denaturing PAGE purification as described above ...
-
bioRxiv - Genomics 2021Quote: The beads were magnetically separated and 4 µl of hot PNK mix (0.2 µl PNK [New England Biolabs], 0.4 µl 32P-γ-ATP, 0.4 µl 10x PNK buffer [New England Biolabs], 3 µl H2O) was added and incubated for 5 min at 37°C in a thermomixer at 1,100 rpm ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl 10 pM/μl TrAEL-seq adaptor 1 and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L). Plugs were then rinsed with 1 ml tris buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Molecular Biology 2020Quote: ... was linked to the free hydroxyl group at the 3’-end of transcripts (1 □g of total RNA) by T4 RNA ligase 1 (NEB M0204) in the presence of 15% (w/v ...
-
bioRxiv - Microbiology 2020Quote: ... 3 mM MgCl2 (NEB), 0.24 mg.ml−1 BSA (Fermentas) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 3 (NEB #E7710) were used to create unique identifiers for each cDNA library sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 µL MNase (NEB) was added to a clarified K562 lysate from ∼5 M cells and digested for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3’ NotI (NEB) before being tested by sequencing (Macrogen ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 µL SUPERase•In RNase Inhibitor and 1 µL T4 RNA Ligase 2 truncated KQ (NEB, M0373L) were added to the RNA-adapter mixture ...
-
bioRxiv - Developmental Biology 2020Quote: ... digested vectors by a 1:2 mixture of T4 ligase (NEB, M0202L) and T4 polynucleotide kinase (NEB ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 µL of 10mM dNTPmix and 2 µL of Phusion polymerase (NEB). PCR products were purified using the QIAquick PCR purification column and eluted with 30 µL Qiagen Elution Buffer ...
-
bioRxiv - Microbiology 2021Quote: ... 7 μl PEG8000 and 1 μl T4 RNA ligase 2 K227Q (NEB) at 25 °C for 1 h ...
-
bioRxiv - Bioengineering 2022Quote: ... 1X of a restriction enzyme mix [1/2 EcoRI-HF® (NEB #R3101 ...
-
bioRxiv - Biophysics 2022Quote: ... 2 μL of a 0.4 µg µL-1 stock of Trypsin (NEB) were added to the samples (to a final enzyme:substrate ratio of 1:50 w/w ...
-
bioRxiv - Genetics 2022Quote: ... were ligated using a 1:2 mixture of T4 ligase (NEB, M0202L) and T4 polynucleotide kinase (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µl of 100µM DTT and 1 µl of NudC (M0607S, NEB), then incubated for 30 min at 37°C ...
-
bioRxiv - Genomics 2023Quote: ... dsDNA was digested by MmeI solution (1× NEB Cutsmart, 2 U MmeI) at 37 °C for 0.5 h and extracted with 12% native polyacrylamide TBE gel (∼84 bp band) ...
-
bioRxiv - Genetics 2023Quote: ... 2 μL 1 M CaCl2 and 5 μL micrococcal nuclease (NEB, #M0247S) were added and chromatin was fragmented into predominantly mono-nucleosomes by incubation at 37°C for 15 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
bioRxiv - Developmental Biology 2023Quote: ... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.
-
bioRxiv - Neuroscience 2021Quote: ... samples were washed four times with 2×SSC and stored at 4 ⁰C in 2×SSC supplemented with 1:1000 murine RNase inhibitor (NEB M0314L) prior to imaging.
-
bioRxiv - Cancer Biology 2021Quote: ... or a polyclonal rabbit antibody against cleaved casp-3 (1:100; New England Biolabs, Frankfurt, Germany), followed by a biotinylated goat anti-rabbit secondary antibody (Abcam ...
-
bioRxiv - Genomics 2020Quote: ... 1 μL of 10 mM dATP and 15 units of Klenow 3’ → 5’ exo- (NEB M0212L) was added to blunted ends and incubated at 37°C for 30 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... Positive control slides were treated with 3 U/mL DNase-1 (New England Biolabs, Cat. M0303) for 10 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... Pre-adenylated L3-1R-App 3’ adaptors were ligated using T4 RNA ligase 1 (M0204, NEB) for 75 min at 25°C ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µL of 10% SDS and 3 µL of proteinase K (New England Biolabs, Ipswich, MA) were added to the suspension ...
-
bioRxiv - Molecular Biology 2024Quote: ... Tat or 3’ LTR by ligation using 1 U of T4 DNA ligase (New England Biolabs) as per manufacturer’s instructions ...