Labshake search
Citations for New England Biolabs :
101 - 150 of 6243 citations for 1 2 Chloropyridin 3 yl 3 3 dimethylazetidin 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... followed by addition of 3’-A overhangs using Klenow Fragment 3’-5’ exo- (NEB, M0212S). After denaturation of DNA at 95°C for 3 min ...
-
bioRxiv - Cell Biology 2021Quote: ... A-tailing 3’ end was performed using Klenow Fragment (3’→5’ exo-) (New England Biolabs), and then TruSeq Adapters were ligated by Quick T4 DNA Ligase (New England Biolabs) ...
-
bioRxiv - Immunology 2022Quote: ... and nCoV_IP4-14084Probe(+) TCATACAAACCACGCCAGG [5’]Hex [3’]BHQ-1 19) and the Luna Universal Probe One-Step RT-qPCR Kit (NEB). Serial dilutions of a titrated viral stock were analyzed simultaneously to express viral loads as eqPFU per gram of tissue.
-
bioRxiv - Microbiology 2024Quote: ... and nCoV_IP4-14084 Probe(+)TCATACAAACCACGCCAGG [5’]Hex [3’]BHQ-1) and the Luna Universal Probe One-Step RT-qPCR Kit (NEB). Serial dilutions of a titrated viral stock were analyzed simultaneously to express viral loads as PFU equivalents (eqPFU ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl of 10 mM dATP and 3 μl of 5 U/μl of Klenow fragment (3′→ 5′ exo (-)) (NEB, M0212) were added and the sample was incubated for 30 min at 37 °C followed by a deactivation step at 65 °C for 20 min ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5’-CCTGACATGCCTGATCCTCT-3’) and exon 5 (5’-GTGTTCTTACCACCTCCCC-3’) with Q5 high-fidelity hot-start polymerase (NEB # M0493L). Thermocylcing parameters were as follows ...
-
bioRxiv - Developmental Biology 2023Quote: ... the coding sequence of alg-1 was amplified from genomic DNA using PCR and primers 5’- acaaggacgacgacgacaagatggaagaccaatggttgct-3’ and 3’- cagttggaattctacgaatgttaagcaaagtacatgacgttgttggc-5’ and the coding sequence of mKate::3xFLAG was amplified from a plasmid containing mKate::3xFLAG using PCR and primers 5’-cggcatcgacgacgacgacgatggtttccgagttgatcaagg-3’ and 3’- cttgtcgtcgtcgtccttgtagtcgatAtcgtggtccttgtagtcaccgtcgtggtccttgtagtccttacgatgtccgagcttgg-5’ and the vector containing rgef-1p and unc-54 3’UTR was amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mKate::3xFLAG::alg-1 by using Gibson assembly (NEB E2611). To generate a DNA plasmid containing rgef-1p::mKate::3xFLAG::alg-2 ...
-
bioRxiv - Neuroscience 2023Quote: ... a 3′ RNA adapter with a phosphate on its 5’ (5’- /5Phos/r(N:25252525)r(N:25252525)r(N:25252525)rUrGrGrArArUrUrCrUrCrGrGrGrUrGrCrC rArArGrG/3SpC3/-3’) end was ligated to RNA 3’ ends using T4 RNA ligase 1 (NEB, M0437) at 25 °C for 75 min (with gentle agitation every 10 min) ...
-
bioRxiv - Genomics 2022Quote: ... then A-tailed by incubating for 1 h at 37°C with 200 μM dATP and 0.2 U/μL Klenow fragment (3’-5’ exo-) in NEBuffer 2 (NEB), then Illumina PE adapter was added by incubating overnight at 20°C with 15 μM PE adapter and 2000 U T4 DNA ligase in ligase buffer ...
-
bioRxiv - Bioengineering 2023Quote: ... and assembled with PCR amplified (primers 2 and 3) pRSET vector fragment using Gibson assembly (NEB Japan, Tokyo, Japan) to add T7 promoter ...
-
bioRxiv - Neuroscience 2024Quote: ... Reverse: 5’-GCTGCCAGTCCAATAGAGGG-3’) were used with the Luna Universal One-Step RT-qPCR Kit (NEB) with SYBR Green detection on the CFX96 (Bio-Rad ...
-
bioRxiv - Genomics 2020Quote: ... 1 μl (3 U/μl) of T4 DNA polymerase (NEB), 1 μl (10 U/μl ...
-
bioRxiv - Genetics 2023Quote: ... 1 μl T4 PNK (3′ phosphatase minus, New England BioLabs)) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3’ end filling and dA tailing was performed by Klenow Fragment (3’>5’ exonuclease deficient; NEB). Libraries were prepared by ligation of NEBNext adapters and indexed i7 primers (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Pu TKamplicon (5’-CTGTTTTCATTCTGCCTTTTGACCATAGAGCCCACCGCATCC-3’ and 5’-GCCAACAAAGAAAGCCTCACTACC GGGTAGGGGAGGCG -3) and Gibson Assembly master mix (NEB) following the manufacturer’s guidelines.
-
bioRxiv - Molecular Biology 2021Quote: ... 3 ml of Thermolabile ExoI (BioLabs) was added to each reaction and samples were incubated for 15 min at 37 °C ...
-
bioRxiv - Bioengineering 2021Quote: 3 μL of 5′-deadenylase (NEB) were added to ligation reaction,
-
bioRxiv - Molecular Biology 2021Quote: ... Then 3 μl USER Enzyme (NEB) was used with size-selected ...
-
bioRxiv - Neuroscience 2020Quote: ... 3’ overhangs removed with Klenow (NEB) to form blunt ends ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 µl T4 DNA ligases (NEB), and 2 µl of a 15 µM Illumina indexed adapter at room temperature for 1 hour ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL 10xDNase I Buffer (NEB), and 24 μL WB2 ...
-
bioRxiv - Genomics 2023Quote: ... 3 µL 10x NEBuffer 4 (NEB), 3 µL of 1 mM each dATP/ddCTP/ddGTP/ddTTP (dATP/ddBTP ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 3 μl QuickCIP enzyme (NEB) at 37°C for 10 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... and 3 µL RNase A (NEB) in volumes normalized to OD600 of culture samples ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 3 μL USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Microbiology 2023Quote: ... 3 µL 10x reaction buffer (NEB), 0.25 µl 1 M MgCl2 and 0.3 µl Rnasin ribonuclease inhibitor (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... Then 3 μL USER Enzyme (NEB) was used with size-selected ...
-
bioRxiv - Genomics 2023Quote: ... Klenow Fragment (3’→5’ exo-) (NEB) was diluted in 1X NEBuffer 2 to a final concentration of 2 U/μL ...
-
bioRxiv - Plant Biology 2022Quote: ... and 3 (NEB, catalog No. E7500S) following manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Genomics 2024Quote: ... 3 µL 10x ThermoPol buffer (NEB), 3 µL H2O and Therminator IX (NEB 10 U/µL ...
-
bioRxiv - Microbiology 2024Quote: ... and 3 μL of QuickCIP (NEB). The reaction was incubated at 27°C for 20 minutes followed by inactivation at 80°C for 2 minutes ...
-
bioRxiv - Genomics 2024Quote: ... 3 µl of USER (NEB # E7103L) was added for 20 min at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 μl of XbaI (NEB R0145S) was used to digest 6 μg of the pcDNA3.1-Cas9 vector ...
-
bioRxiv - Systems Biology 2024Quote: ... 3 µL BsiWI-HF (NEB, R3553), 3 µL MluI-HF (NEB ...
-
bioRxiv - Systems Biology 2024Quote: ... 3 µL MluI-HF (NEB, R3198), and nuclease-free water to 150 µL at 37 °C for 1 hour ...
-
bioRxiv - Plant Biology 2022Quote: ... 250 μL 2× lysis buffer (20 mM Tris-HCl, 40 mM Na2EDTA, 1% (w/v) SDS) and 3 μL proteinase K (NEB: P8102S, 20 mg/mL) were added and incubated under agitation at 55°C for 2 h ...
-
bioRxiv - Biophysics 2020Quote: ... for 2 h at 37°C and IFITM3-iSNAP was stained with 3 µM SNAP-cell 647-SIR (New England Biolabs) at the same time ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the NIR fluorescent adaptor (5′-OH-AGATCGGAAGAGCGGTTCAGAAAAAAAAAAAA/iAzid eN/AAAAAAAAAAAA/3Bio/-3′) was ligated to the RNA using truncated RNA ligase 2 K227Q (NEB) overnight at 16°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... NC-siRNA sense: 5’-AGGUAGUGUAAUCGCCUUGdTdT-3’.35,36 NEBuffer™ 2 and nucleoside digestion mix were obtained from NEB (Ipswich, MA). Adenosine and N6-methyl adenosine (m6A ...
-
bioRxiv - Molecular Biology 2021Quote: ... An adenylated adaptor was ligated to the 3’-end of the captured transcripts (Supplementary Table 3) by using a mixture of T4 RNA ligase and truncated T4 RNA ligase 2 (ThermoFisher Scientific and NEB), which served as a template for the reverse transcription primer (Supplementary Table 3) ...
-
bioRxiv - Genomics 2020Quote: ... followed by ligation of 3’ ends with pre-adenylated DNA adapters (App-GATCGTCGGACTGTAGAACTCTGAAC/3InvdT/) using T4 RNA Ligase 2 truncated K227Q (NEB) in absence of ATP ...
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Molecular Biology 2023Quote: ... or MnlI was at 37 °C for 2 h (EcoRI-HF) or 3 h (HhaI or MnlI) in rCutSmartTM Buffer (NEB). Nuclease S1 (Boehringer Mannheim ...
-
bioRxiv - Systems Biology 2024Quote: ... We digested ∼2ug of each of 24 barcoded ORF plasmid pools (2 replicate pools of each of 9 hORFs and 3 vORFs) overnight with I-SceI (NEB) according to manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Developmental Biology 2023Quote: ... for small RNA library preparation 50 to 300 ng of total RNA was ligated with randomized 3’ adapter using T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monophosphorylated RNAs were ligated to 3′ adapters ( rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/, IDT) using T4 RNA ligase 2 in 25% PEG 8000 (NEB) at 15°C overnight ...
-
bioRxiv - Genetics 2022Quote: ... Purified sRNA was ligated to a 32 nt 3’ adaptor including unique barcodes (sRBC, Table S5, IDT) with truncated T4 RNA ligase 2 (M0373L, NEB) overnight at 16°C ...