Labshake search
Citations for New England Biolabs :
51 - 100 of 3523 citations for N Furan 2 ylmethyl 3 bromo 4 fluoro benzamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: Total RNA was isolated from frozen hDRG tissue and GBP- or vehicle-treated primary hDRG cultures (n = 3 per condition) using the Monarch Total RNA Miniprep Kit (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... A 5’-adenylated DNA adapter (5’-rAppAGATCGGAAGAGCACACGTCT-NH2-3’) was added to 3’-ends using truncated T4 RNA ligase 2 (New England Biolabs; M0242S). After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 mM MgCl2 and 2 μL (10 U) RNase H (NEB, Cat# M0297S) in order to digest poly(A ...
-
bioRxiv - Genetics 2022Quote: ... N is for a random nucleotide) were ligated to the small RNA by T4 RNA ligase 2 (NEB) and T4 ligase 1 (NEB ...
-
bioRxiv - Biophysics 2021Quote: ... of 0.1M sodium hydroxide: 0.02M 2-(n-morpholino) ethanesulfonic acid (MES) or 1X NEB DNase I reaction buffer (NEB B0303S ...
-
bioRxiv - Microbiology 2021Quote: ... Standard curve was prepared using SARS-CoV-2 Positive Control plasmid containing full nucleocapsid protein (N gene) (NEB) and used to quantify copies of N gene in organoid samples ...
-
bioRxiv - Microbiology 2024Quote: ... N-4005, and N-4004) were used to cap available 3’-terminal ends using terminal transferase (1 µl, 20 units) (NEB #M0315S), TdT reaction buffer (1.5 µl) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM MgCl2 and 4 units of RNase Inhibitor Murine (NEB, M0314). After 30 min at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... Cleared lysate containing the nucleosomes was incubated with purified MBP-tag or MBP-FoxP3ΔN protein (1uM) for 1 hour at 4℃ and then subjected to MBP pulldown using Amylose Resin (New England Biolabs). After proteinase K (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... The digested DNA (4 ml in total) was split into 4 aliquots and diluted in 8 ml ligation buffer (1X ligation buffer NEB 3 (without ATP), 1 mM ATP ...
-
bioRxiv - Cancer Biology 2023Quote: ... and ligated to hairpin adaptor 2 (ENDseq-adaptor-2, 5′-Phos-GATCGGAAGAGCACACGTCUUUUUUUUAGACGTGTGCTCTTCCGATC*T-3′ [*phosphorothioate bond]) (Quick ligation kit, NEB). To prepare libraries for sequencing ...
-
bioRxiv - Microbiology 2024Quote: ... 5’ pir-2 flank::PtrpC::nat::3’ pir-2 flank assembly was constructed using NEBuilder Assembly Kit (New England Biolabs). Each assembly fragment was either synthesized (T4 Oligo ...
-
bioRxiv - Bioengineering 2024Quote: ... The RNA template of the SARS-CoV-2 N gene was synthesised using in-vitro transcription (Hiscribe, NEB, US) and a template plasmid (Molecular Diagnostics Collection ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) for A-tailing at 37°C for 30 min ...
-
bioRxiv - Plant Biology 2021Quote: ... for 3 hours at 55°C and M-2 was digested with XhoI (NEB) overnight at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adenylation reactions were conducted by adding 5 μL of NEB buffer 2 (NEB), 1 μL 10 mM dATP ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was ligated with 3′-adenylated adapters using T4 RNA Ligase 2 (NEB #MO351) for 4 hrs at 16°C ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was generated from RNA using 4 µL of 5X ProtoScript II buffer (cat. n° M0368L, NEB, New England Biolabs, USA), 2 µL of 0.1 M Dithiothreitol (cat ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was generated from RNA using 4 µL of 5X ProtoScript II buffer (cat. n° M0368L, NEB, New England Biolabs, USA), 2 µL of 0.1 M Dithiothreitol (cat ...
-
bioRxiv - Biophysics 2024Quote: ... The N-glycans of Fc were unified by adding 1 nmol of β1-4 Galactosidase S (New England Biolabs, Tokyo, Japan) per 1 unit of glycan terminus (mixed so that the enzyme solution was 10% of the total reaction solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3-4 μg of sperm gDNA was dephosphorylated with 10 μl of rSAP (NEB, no. M0371S) and 16 μl of 10× rCutSmart buffer (NEB ...
-
bioRxiv - Biochemistry 2021Quote: pMAL-c4E vectors carrying in-frame fusions of the EFR cytoplasmic domain with the N-terminal maltose-binding protein (MBP) tag were transformed into Rosetta 2 cells (NEB) for recombinant protein expression ...
-
bioRxiv - Neuroscience 2020Quote: ... Engineered SiR vectors carrying d.C1349G or d.G1357T PEST-targeting mutations were produced by PCR amplification of the Rabies genome in 2 fragments starting from the end of N assembled using Gibson master mix (NEB).
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were heated for 1 minute at 100°C followed by the addition of 2 μL of peptide N-glycosidase F (New England Biolabs) to release the N-glycans ...
-
bioRxiv - Genomics 2020Quote: ... add 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) to digest the unligated DNA fragments at 37°C for 40 min ...
-
bioRxiv - Molecular Biology 2020Quote: 3’ linker ligation (1x PNK buffer, 800 u T4 RNA ligase 2 truncated KQ (NEB), 80 u RNaseOUT ...
-
bioRxiv - Molecular Biology 2023Quote: ... samples were incubated with 1.5 µl EndoH and 2 µl 10× GlycoBuffer 3 (all NEB) buffer at 37°C 1h ...
-
bioRxiv - Neuroscience 2021Quote: ... samples were washed four times with 2×SSC and stored at 4 ⁰C in 2×SSC supplemented with 1:1000 murine RNase inhibitor (NEB M0314L) prior to imaging.
-
bioRxiv - Cell Biology 2022Quote: ... An IFT144 construct lacking the N-terminal β-propeller domain (residues 2–349 inclusive; IFT144ΔNFLAG) was made using the Q5® Site-Directed Mutagenesis Kit (NEB).
-
bioRxiv - Molecular Biology 2020Quote: ... Products were then ligated to 3’ adaptor (/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) by T4 RNA ligase 2(NEB) and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Vcan exon 2 and exon 3 were amplified using Phusion Taq (NEB, catalog no. F530L) (see SI) ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mM 3’-O-Me-m 7G(5’)ppp(5’)G cap structure analog (NEB S1411S), 0.5 mM GTP ...
-
bioRxiv - Biochemistry 2023Quote: ... The tRNA 2’-3’ cyclic phosphate was removed by treatment with T4 PNK (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... and ligated to the 3′ adapter by incubating with T4 RNA ligase 2 truncated mutant (NEB) and 1 µg of pre-adenylated adapter (5′rAppCTGTAGGCACCATCAAT/3ddc ...
-
bioRxiv - Biochemistry 2024Quote: ... the RNA was ligated to the 3′ adaptor tRNA using T4 RNA ligase 2 (NEB, M0351L) for 2 h at 37°C ...
-
bioRxiv - Genomics 2021Quote: The beads were magnetically separated and resuspended in 20 µl of 3’ end RNA dephosphorylation mixture (4 µl 5x PNK pH 6.5 buffer, 0.5 µl PNK [New England Biolabs; with 3’ phosphatase activity] ...
-
bioRxiv - Immunology 2024Quote: ... and β-N-Acetylglucosaminidase S (NEB), or all three enzymes were performed overnight at 37 °C using 1 unit each of enzyme ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL ligation mix (2 µL 10x T4 ligase buffer, NEB, 1 µL T4 RNA ligase 2, truncated, NEB, 1 µL Ribolock inhibitor) was added and incubated (1 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... µM GAT-7N primers (5′- GTG AGT GAT GGT TGA GGT AGT GTG GAG NNN NNN N) and 2 units/µl DeepVent® (exo-) DNA polymerase (New England Biolabs, M0259L) in the programmable thermal cycler for 11 cycles ...
-
bioRxiv - Genomics 2024Quote: ... 0.5 µM GAT-7N primers (5′-GTG AGT GAT GGT TGA GGT AGT GTG GAG NNN NNN N) and 2 units/µl DeepVent® (exo-) DNA polymerase (New England Biolabs, M0259L) and incubated for 11 cycles in the BioRad thermocycler ...
-
bioRxiv - Biochemistry 2021Quote: ... pH 7.5 and de-N-glycosylated using 500 U N-glycosidase F (PNGase F, New England Biolabs) for 12 h at 37°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... ΔN1/2/3 and ΔDAD mutants were generated by Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) with HOXB13 WT or NCOR1 WT as a template ...
-
bioRxiv - Microbiology 2022Quote: ... 23 nt RNA (5’-GAAUCUAUACAUAAAGACCAGGC-3’) was capped with vaccinia capping enzyme and 2’-O-methyltransferase (NEB) and radiolabelled with [α 32P]-GTP ...
-
bioRxiv - Immunology 2020Quote: ... (2) and (3) was synthesized through HiScribe™ T7 ARCA mRNA Kit (with tailing) (New England Biolabs). All the mRNA products were concentrated and purified via EZ-10 Spin Column RNA Cleanup & Concentration Kit (Bio Basic Inc.) ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μl of RNase inhibitor and 3 μl of T4 RNA ligase 2 (truncated) (New England Biolabs) were added and mix well by pipetting ...
-
bioRxiv - Molecular Biology 2023Quote: ... the 3’adapter was ligated to the dephosphorylated RNA using T4 RNA ligase 2 KQ (NEB, M0373L) at 25°C for 1h ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA 3′-ends were dephosphorylated in a 10 µL reaction with 2 µL T4 PNK (NEB #M0201S) 1 µL of FastAP Thermosensitive Alkaline Phosphatase (ThermoFisher #EF0651) ...
-
bioRxiv - Molecular Biology 2023Quote: RNA 3′-ends were dephosphorylated in a 10 µL reaction with 2 µL T4 PNK (NEB; #M0201S) 1 µL of FastAP Thermosensitive Alkaline Phosphatase (ThermoFisher #EF0651) ...
-
bioRxiv - Molecular Biology 2022Quote: 3’ linker ligation (1x PNK buffer, 800 U T4 RNA ligase 2 truncated KQ (NEB, Cat#M0373L), 80 U RNaseOUT ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... were ligated to 3′ barcoded DNA adapters using truncated T4 RNA ligase 2 (New England Biolabs, #M0373). These fragments were separated in an 12% denaturing polyacrylamide-urea gel ...